Archive for setembro, 2011

LUZ: O que é, e como se obtem o Raio Laser

sexta-feira, setembro 30th, 2011

Extraído do artigo:

Meio século de laser

http://www.revistapesquisa.fapesp.br/?art=6940&bd=2&pg=1&lg=

Pesquisa FAPESP – Online

O dispositivo funciona por meio da chamada emissão estimulada, que consiste no seguinte. Vamos supor a existência de um elétron que esteja num estado que não é aquele no qual ele tem menor energia. Estamos então nos referindo a um estado excitado. Esse elétron excitado apresenta uma forte tendência a ir para o nível de mais baixa energia. Porém, esse processo sozinho é extremamente demorado para ocorrer. Mas pode ser antecipado com a ajuda de um agente externo, que estimula o processo. O agente externo, nesse caso, é uma porção de luz denominada fóton. Dessa forma, um fóton externo estimula o decaimento do elétron excitado. Ao passar para o estado de energia mais baixa, o elétron emite um fóton que emerge do sistema juntamente com aquele que causou a transição. Desse modo, na emissão estimulada, o fóton estimulador (externo) sai intacto e o fóton gerado é o seu irmão gêmeo. É um verdadeiro processo de clonagem de luz.

Esses dois fótons que emergiram da emissão estimulada vão perturbar outros átomos com elétrons em seus estados excitados, havendo emissão de mais fótons que se juntam aos iniciais. O processo ocorre como se fosse uma avalanche de emissões estimuladas. Após vários passos, os fótons que se movimentam através do eixo principal da cavidade óptica do laser – que é composta pelos espelhos ao redor do meio ativo – constituirão um feixe que apresenta uma intensidade considerável. Uma abertura ou a reflexão parcial num dos espelhos das extremidades permite que, continuamente, uma fração dessa luz deixe o sistema. Essa fração é que constitui o feixe de luz laser.

A utilização do laser está tão comum hoje que muitos nem lembram que um dia ele foi inventado. O instrumento está tão popularizado, que parece que ele passou da ficção científica para a realidade há tempos que se perdem de vista. Mas a história desse fantástico instrumento não é tão velha assim. Em 2010, comemoramos os 50 anos de existência de sua invenção. Alguns dos protagonistas principais dessa façanha estão ainda vivos e, por incrível que pareça, os verdadeiros créditos de sua invenção ainda são debatidos. Vamos falar um pouco de sua história e depois de sua importância.

A invenção do laser não foi obra do acaso e de fato envolveu uma disputa de renomados cientistas. No final da década de 1950, a corrida para chegar ao laser começa nos laboratórios da antiga Bell Telephone Laboratories, em Nova Jersey, Estados Unidos. Anos antes, no mesmo laboratório, grupos de cientistas liderados por Charles H. Townes (trabalhando como consultor da Bell, mas com cargo permanente na Universidade Columbia), desenvolveram a ideia de um dispositivo que poderia amplificar de forma ordenada a radiação eletromagnética no regime de microondas. Em 1953, a proposta foi bem-sucedida e nascia o maser, irmão mais velho do laser, que obedece princípios semelhantes, porém operava na região espectral do microondas.

Após essa magnífica demonstração, muitos cientistas de forma independente tiveram a ideia de aplicar o mesmo princípio, só que na região do espectro visível. Dessa forma, produziram um raio de luz coerente de baixa divergência visto antes apenas nos filmes do Flash Gordon. Diferentes propostas foram testadas em diferentes laboratórios. Por volta de 1960 entra no cenário da competição mais um personagem: Theodore Harold Maiman (1927-2007), um engenheiro dedicado à física que havia sido aluno de W. Lamb, na Universidade de Stanfort, e tinha trabalhado com física atômica. Maiman fez acordos especiais com o laboratório em que trabalhava para poder testar suas ideias na produção de luz coerente. Diferentemente de Arthur L. Schawlow (1921-1999), outro pioneiro do setor, e seus colaboradores que trabalhavam para gerar luz laser a partir de vapores atômicos, Maiman propôs produzir luz coerente a partir de um cristal de rubi. Foi bem-sucedido nessa aposta em maio de 1960, mostrando ao mundo os primeiros pulsos de luz amplificada por emissão estimulada: nascia o laser.

Muitos centros de pesquisa científica e tecnológica, espalhados por todos os cantos de nosso planeta, dedicam-se integralmente ao estudo do laser e de suas aplicações. Num futuro não muito distante é possível que tenhamos lasers implantados dentro de nosso corpo para realizarem diagnósticos de distúrbios ou doenças – e que também poderão promover o tratamento adequado desses problemas de saúde. A cada semana, cerca de uma centena de novos usos do laser em diversos campos da ciência são propostas ou demonstradas na vasta literatura mundial sobre esse tema.

Dada a enorme importância do laser na atual sociedade moderna, seu conhecimento deixa de ser importante apenas para os especialistas e passa a ser de interesse de todos aqueles que procuram conhecer o mundo ao seu redor. Aqui no Brasil temos diversos centros trabalhando em desenvolvimento e aplicativos de lasers. As contribuições são diversas, indo desde o controle dos átomos, passando por investigações de propriedades de materiais e aplicações industriais até o próprio desenvolvimento de novos lasers. É certamente uma área fantástica para quem quiser fazer a diferença em ciências, pois as oportunidades estão se expandindo. Para saber mais desse maravilhoso instrumento e suas aplicações há diversos livros no mercado. Laser e suas aplicações em ciência e tecnologia (Editora Livraria da Física, 88 páginas), pelo autor desta coluna, é uma das opções.

Método Cientifico: Sôbre a Integridade Ética da Pesquisa – FAPESP

sexta-feira, setembro 30th, 2011

Boas práticas científicas

FAPESP lança código para garantir a integridade ética da pesquisa
http://revistapesquisa.fapesp.br/?art=71731&bd=2&pg=1&lg=

Observar que no artigo há um link para:
“Sobre a integridade ética da pesquisa”, de Luiz Henrique Lopes dos Santos

Big Bang Theory

sexta-feira, setembro 30th, 2011

NASA

WMAP’s Universe – Universe 101

http://map.gsfc.nasa.gov/universe/bb_theory.html

Luz e Origem da Vida: Compostos Orgânicos Formados no Infra-Vermelho de Estrêlas

quarta-feira, setembro 28th, 2011

Artigo no: TG Daily

http://www.tgdaily.com/space-features/59309-stars-create-complex-organic-molecules

Stars create complex organic molecules

Posted on October 28, 2011 – 03:41 by Kate Taylor

“The researchers were investigating a set of infrared emissions detected in stars, interstellar space and galaxies, and known as Unidentified Infrared Emission features.

These signatures were believed to have come from simple organic molecules made of carbon and hydrogen atoms, called polycyclic aromatic hydrocarbon (PAH) molecules.

But, using the Infrared Space Observatory and the Spitzer Space Telescope, Kwok and Zhang discovered that the spectra have features that can’t be explained by PAH molecules.

Instead, they say, the substances generating these infrared emissions have chemical structures that are much more complex.

Analysis of the spectra of star dust formed in novae shows that stars are making these complex organic compounds in a matter of weeks, and then ejecting it into the general interstellar space.

Interestingly, this organic star dust is similar in structure to the complex organic compounds found in meteorites, and could form their source. Thus, it’s possible that life on Earth developed from this organic star dust.”

Comentário da Matrix/DNA:

Como vemos no grafico do espectro de luz, o infra-vermelho corresponde à fase entre jovem/adulto. Como vemos nos modêlos da Matrix/DNA, os fótons-genes que compuseram as moléculas da Vida vieram de dois lugares: a) do nucleo do planeta (os 50% correspondentes à face esquerda, ou seja, do nascimento à juventude), e b) das estrêlas ( os 50% que correspondem à face direita, ou seja, do adulto ao cadáver). A noticia acima está sugerindo que as estr6elas geram compostos complexos de moléculas orgânicas, os quais emitem no infra-vermelho. É uma confirmação exata dos modêlos, tanto em relação à astro-biofisica quanto à teoria da luz como fórmula do ciclo vital!

Outros Métodos Cientificos Alem do Western Scientific Method?!

domingo, setembro 25th, 2011

Pelo que entendí das criticas do livro abaixo, o método cientifico teria sido deflagrado por uma ideologia e devido alguns sucessos que empower os ideólogos estaria até hoje havendo um feed-back entre a ideologia e um método cientifico ideologísta, o chamado método cientifico ocidental. Haveria outra maneira de abordar a matéria e a natureza e desenvolver todo um conhecimento diferente? De fato não aprecio o que a civilização ociental construiu ( 1 – a canalização da massa humana para o trabalho escravo e o entorpecimento da evolução de seus cérebros; 2) as cidades desumanizadas de maquinas e concreto). Haveria um outro método cientifico, naturalista, que mantivesse a mente humana e não o cérebro eletro-mecânico na direção da evolução tecnológica e mantivesse o complexo sensorial humano como fonte de captação de informação ao invés do atual dominio do complexo sensorial mecanicista do computador?!

Preciso ler êste livro.

Decolonizing Methodologies: Research and Indigenous Peoples [Paperback]
Linda Tuhiwai Smith
tem na Amazon.Com

Com 11 criticas de leitores com destaque para a seguinte:

Constructing Critical Indigenous Research Methodologies, April 15, 2003
By Chicano Loco de la Frontera Aztlan (El Paso, Texas) – See all my reviewsThis review is from: Decolonizing Methodologies: Research and Indigenous Peoples (Paperback)
Looking at Western research practices from the underside of a positivist paradigm deeply entrenched and diffused throughout public and private educational, governmental, and corporate tentacles, Linda Tuhiwai Smith is a Maori (New Zealand) intellectual presenting a counter-methodological narrative stemming from a collective indigenous historical cynicism and whose voice bespeaks the refusal to be objectified by an inherently racist and imperialist mode of constructing knowledge and re-presentations of non-Western peoples. Deconstructing Western research paradigms is simply an act of defiance and resistance for Smith, particularly since she constructs a radical alternative methodology rooted in self-determination, social justice, intellectual property rights, and active participation in all knowledge-making, contributions to the research processes, and dissemination of findings. The exigency of articulating a research methodology aimed at critical praxis for Western and non-Western peoples interested in indigenous issues emerges at a point where globalization and neo-liberal imperial practices and investments are opening new spaces for the unilateral and/or predominant benefit of Western research regimes that continue capitalizing and objectifying indigenous peoples through racist and incorrigible projects that erase human dignity, i.e. Human Genome Diversity Project.
The book can strategically be divided into two main sections: the first section explores the contemporary and historical legacy of an imperial tryst between Western scientific, economic, and ideological formations shaping relations with alterity (Chapters 1-5); the second section outlines a radical alternative methodology for conducting research on indigenous peoples and issues (Chapters 6-9). The first chapter reveals the Enlightenment and positivist threads that weave imperialism, history, writing, and theoretical practices that continue to shape current research and socio-political policies on an international level. Smith states: research within late-modern and late-colonial conditions continues relentlessly and brings with it a new wave of exploration, discovery, exploitation, and appropriation (24). Deconstructing the historical legacy of imperial practices is also a call for rewriting and rerighting history with indigenous perspectives. The second chapter outlines the Baconian processes by which Westerners come to view the world as a standing reserve of objects for empirical inquiry, discursive appropriation, and mimetic comportment processes aimed at subjugating and controlling nature and indigenous peoples with an intellectual will to power stemming from racist ideologues who trace some form of theoretical lineage back to Bacon, Kant, Hegel, Hume and others. Borrowing from Stuart Hall, this process moves from classification of the world and others, to collapsing images for a convenient system of representation, to presenting a reified model for comparative analysis, and, finally, establishing criteria for hierarchical positionality. Chapter three delves further into deconstructing research, as viewed through imperial eyes, and how this methodology produced a self-perpetuating apparatus comprised of multifarious disciplines for the construction and future survival of colonial knowledge and all those who invest in these truth regimes that purport to be universal, neutral, objectively sound, and constructed on a foundation of absolute certainty.

Chapter four and five highlight many instances of how imperial research regimes continue to invest in the discursive and scientific construction, re-presentation, and exploitation of indigenous peoples for profit and social control. The globe has become one large information colony where research is the means to inscribe social and ideological control and Westernized fabrications of history on the backs of indigenous peoples around the world. The most infamous example of how the imperial research regime continues to exist is through scientific projects stemming from private corporate entities mainly subsidized by governments. The Human Genome Diversity Project attempts to subjugate indigenous peoples by mapping and reifying DNA and possessing it as intellectual property for future use. The attempt to patent the genetic make-up of the Hagahai people (New Guinea) by the U.S. government is indisputable proof of how these scientific projects threaten the future, autonomy, and human rights of indigenous peoples.

The second part of the book focuses on constructing an indigenous alternative to decolonize indigenous peoples from Western regimes of research based on emergent tribal social issues, practices, and beliefs. The center of this decolonizing project is constructed through Polynesian metaphors of space-time. The center of social activity and identity is an archipelago comprised of self-determination in terms of tribal autonomy on a social, economic, and research level, as well as the full participation in inter-tribal and inter-national relations. Healing, decolonization, transformation, and mobilization are the four main directions that frame the spaces of this project. Survival, recovery, and development are the main tides that connect and transform all directionality of the project. This methodology is intended to transform indigenous peoples from passive objects in Western research to active-participants in an indigenous process of reconfiguring themselves and the world around them. Respect becomes the main affective principle for the survival of indigenous peoples and the project: through respect, the place of everyone, and everything in the universe is kept in balance and harmonythe denial by the West of humanity to indigenous peoples, the denial of citizenship and human rights, the denial of the right to self-determinationall these demonstrate palpably the enormous lack of respect which has marked the relations of indigenous and non-indigenous peoples (120). Without respect, there is no dignity.

Chapter seven outlines a means of articulating such a project to indigenous and non-indigenous peoples and the challenges associated with it. Chapter eight provides a list of current indigenous research projects. Chapter nine provides a case study of the Maori peoples in which the method outlined in chapter six was put into practice. Chapter ten details with the methodological transformation of passive objects to active agents and lists tactics for strengthening and sustaining critical research for decolonizing processes.
Generally, when the researched become researchers, self-determination and healing can take place, communities can create and control research processes and the subsequent naming of the world, and they can define their relationship with others and the environment.

If a critical theroetical/methodological flaw or problematic of this decolonial methodology exists, it might come to presence from a post-structural disdain for outlining a process by which people can liberate themselves from Western imperialist research regimes. But then again, post-structural thought is mainly a Western construction and/or response to
‘modernity’ and its discontents.

Choice architecture:O Método que a Arquitetura LUCA nos Conduz Ao Robótico Novo Mundo?

sábado, setembro 24th, 2011

Nós existimos dentro de um Sistema Solar que funciona como um relógio. Se nosso ambiente e nós mesmos tivéssemos sido criados apenas dentro e pelo Sistema Solar, tanto nossa biosfera como nós mesmos, funcionaria tudo como um relógio, mecanicamente. Claro, as fôrças e leis naturais funcionam na base do “tal causa, tal efeito”. Aliás, não seria biosfera e sim mecanosfera, e nada de biológico deveria existir.

Apenas esta constatação seria suficiente para refutar a Moderna teoria do RNA-World, e tôdas as outras que tem como base a crença na emergencia da vida apenas nos ingredientes conhecidos dentro da sôpa primordial terrestre.

Portanto, na teoria de Oparin e na experiência de Urey está faltando ingredientes, e forçosamente tais ingredientes têm que ter vindo de algum outro lugar que não apenas o Sistema Solar tal como captado pelos nossos sentidos e instrumentos cientificos. O que não nos obriga a aceitar a crença em ingredientes supernaturais, pois existem alternativas, como a sugerida pela Teoria da Matrix/DNA, que sugerem ingredientes naturais vindos da galáxia, porem, sugerindo um novo modêlo cosmológico.

Para entender isto é bom fazer-mos uma analogia com o corpo humano. Os fundamentais building blocks do corpo humano são os átomos. Mas quando nos reproduzimos, nossos filhos saem na forma de sistemas atômicos? Não. Os segundos building blocks são as células. Ainda não é um sistema celular a forma de nossos filhos. Em universal macro-evolução acontece a mesma coisa. Sistemas estelares são como átomos, os fundamentais building blocks do Universo, quase que puramente eletro-magneto/mecânicos; êstes compõem os sistemas galácticos, segundos building blocks do Universo. Assim como a forma mais complexa de organização celular desce sôbre os átomos do corpo humano mudando algo em seus comportamentos inorgânicos, assim a galáxia deve ter uma organização mais complexa que o Sistema Solar. Pois galaxias contem novos elementos que sistemas estelares por si só não produzem e nem sempre contem, como buracos negros, quasares, pulsares. Foi por aqui, com êstes tipos de raciocinios que comecei a suspeitar que nosso teórico modêlo de galáxia estava incompleto, a 30 anos atrás no meio da selva amazônica. As leis caóticas e selvagens da selva, filha da galaxia, apontavam para uma diferente forma de sua mãe, e eu acreditava apenas em leis e fôrças naturais.

Portanto a galáxia tem uma organização sistêmica mais complexa, mais evoluida que os sistemas estelares, e a evolução se dá na direção do sólido+gasoso/eletro-magnético/mecânico para tudo isso mais o liquido/semi-biológico. Ao menos é isso que eu via aqui na Terra.

A evolução cosmológica deve ter mudado de direção quando chegou ao sistema galáctico porque êle fechou as portas à evolução quando sua matéria alcançou o estado de perene equilibrio termodinamico e êle se constituiu em sistema fechado em si mesmo. Não creio que o Universo vá nos surpreender mostrando-se como um unico sistema, um corpo vivo. A evolução mudou de direção, no sentido que vinha do menor para o maior, retornando ao microscópico, como nossocorpo, ao se reproduzir, deixa suas dimensões maiores para se resumir em espermatozóides e óvulos microscópicos.

E quando a evolução contra-atacou com sua entropia, liquefez parte da matéria e recomeçou pelo sistema celular. Mas a evolução não é magica. São simples leis e forças naturais em livre curso, talvez com influencias modeladoras do meio ambiente. Ela determina que filho de peixe, peixinho será, mesmo que em outro mundo. E o Sistema Solar não pode ter sido o peixe da célula como peixinho, o salto seria mágico. Por isso voltei os olhos para a galáxia. Por isso re-calculei como deve ser o corpo do peixe.

LUCA seria o ingrediente que está faltando na sôpa de Oparin. Êle seria o agente oculto por trás do que vamos denominar “Choice Arquitecture”. Eu cheguei a êle como o delegado elabora um retrato-falado do assassino e se põe a procurá-lo. LUCA quis me matar na selva porque desobedecí seu comando, pelo qual para sobreviver eu teria que regredir ao estado ancestral de mera maquina biológica, o macaco assassino.

Mas o LUCA da Matrix/DNA seria ainda mais máquina que o Sistema Solar. O motor perpétuo quase-eterno. E êle estaria modelando nosso ambiente à medida que se recobra da enfermidade da entropia. Ao modelar nosso ambiente, seria êle que estaria nos dirigindo a um destino, apesar da aparência de que somos as livres fôrças da evolução em marcha e que teríamos o livre-arbitrio para escolher. Estamos escolhendo o que nos é propagandeado como os slogans da Coca-Cola estão sempre à nossa frente. Estamos escolhendo o que LUCA escolheu para nós. Se não desenvolver-mos racionalmente o intelecto e botar nossa mente como agente da escolha. Se continuarem agindo como os rapazes e garôtas alegres que têm preguiça de estudar e ler artigos longos como êste, que ao menos, exercita o raciocinio.

Mas como seria isso?

Uma nova teoria elaborada por um economista lança luz nessa questão. Vou registrando aqui o material que for compilando a respeito para fazer um estudo final e elaborar mais um artigo:

Amazon.com: What is “choice architecture” and how does it affect the average person’s daily life?

Thaler and Sunstein: Choice architecture is the context in which you make your choice. Suppose you go into a cafeteria. What do you see first, the salad bar or the burger and fries stand? Where’s the chocolate cake? Where’s the fruit? These features influence what you will choose to eat, so the person who decides how to display the food is the choice architect of the cafeteria. All of our choices are similarly influenced by choice architects.

xxxx
From Wikipedia

Choice architecture

Choice architecture describes the way in which decisions are influenced by how the choices are presented (in order to influence the outcome), and is a term used by Cass Sunstein and economist Richard Thaler in the 2008 book Nudge: Improving Decisions about Health, Wealth, and Happiness.[1] Parallels are drawn between choice architecture and traditional architecture. (Ver mais)

xxxxx

The Design Matrix
Designing Evolution

Designing Evolution

Posted on May 30, 2010

xxxxxxxxxxxx

A Morte Explicando Como a Origem da Vida não foi a versão da Ciência Acadêmica

sexta-feira, setembro 23rd, 2011

Artigo baseado em:
http://www.biology-online.org/biology-forum/post-134634.html#p134634 (Vide abaixo o texto)

A Morte Tem a Resposta para como foi a Origem da Vida

Se não podemos voltar atrás, a 3,5 bilhões de anos, para ver como a Vida começou, podemos ver aqui e agora quando ela termina, ou seja, assistindo a morte de um ser vivo, e saber como ela não começou apenas pelas fôrças físicas do mundo pré-biótico e nem com a contribuição das propriedades químicas na abiogênese.

Nos ultimos momentos antes da morte todas as moléculas bioquimicas do corpo ainda estão intactas e funcionando. No justo momento da morte elas ainda estão lá, mas no momento que os mecanismos regulatórios do organismo cessam, as moléculas começam a se desintegrarem.

Em outras palavras, as leis naturais da Física, da Quimica e da Termo-Dinâmica continuam operando mas sem a diretriz reguladora que foi agora removida, e o resultado é degeneração, desintegração, rumo às suas menores partes constituintes.

Portanto, o curso natural que as leis naturais seguem, é o de destruir as moléculas bioquimicas. Mais exatamente, é o de eliminar os vínculos entre os átomos que os organizam bioquimicamente. Desde que êste é o caso comprovado, como podem aquelas mesmas leis naturais guiarem a construção de vida celular, e quanto mais, o organismo inteiro ?!

Elas tem que serem dirigidas e forçadas a seguirem um diferente caminho para serem bem suscedidas na geração da vida. E o agente desta nova direção tem que ser o mesmo que mantem o organismo regulado e vivo. Ou seja: as leis naturais da organização vital já existiam antes da origem da vida. Claro!

Conclusão: seja lá o que for a vida, ela certamente não é parte constituinte da Física ou da Quimica.
Esta é a razão porque a visão naturalista da origem da vida sem algo como a fórmula da Matrix/DNA, sem a visão sistêmica e diferentes modêlos atômicos e astronômicos, é cientificamente ininteligivel. E portanto, a Teoria do RNA-World, tal como está elaborada, é equivocada e/ou incompleta.

Os cientistas da NASA compreenderam isto muito bem, quando emitiram um reporte estabelecendo que ” não existe plausível hipótese de rotas para formação de moléculas bioquímicas complexas, nem quimicamente nem termodinamicamente.”

A NASA emitiu êste reporte a contra-gôsto, foi forçada a isso pela quantidade de evidências. Se existe uma organização necessitada de dar uma explicação natural para a origem da vida esta é justamente a NASA. Lutando contra a escassez de fundos, se êles provassem que as leis naturais conhecidas, apenas por si só, podem dar inicio ao processo e desenvolvimento da vida, que resolveram o mistério da abiogênesis, e como êles estão envolvidos nesta pesquisa principalmente em astrobiologia, receberiam todos os fundos que necessitam. Mas seus administradores e cientistas foram obrigados a se curvarem perante o óbvio.

xxxxxxxxxxxx
Comentário postado por Matrix/DNA sob o artigo:

Jack, thanks by the existence of this blog, very helpful,

The RNA-World Theory became a scientific joke also. No? For instance, comments about this, please:

See the discussion between Craig Venter, Church and Shapiro, in this video

http://www.edge.org/documents/life/life_index.html

And haw do you refute this argument, for instance?

Theories – Origin of Life
http://www.biology-online.org/biology-forum/about14351-204.html

At the moment just prior to death all the biochemical molecules in the dog are still functioning and intact.
At the very moment of death they are still there, however as you rightly point out the regulatory mechanisms cease and the molecules begin to disintegrate.

In other words, the natural laws of physics, chemistry and thermodynamics continue operating but without the guiding regulation that has now been removed, and the result is degeneration, down to their constituent parts.

Therefore the natural course that natural laws take, breakdown biochemical molecules.
Since that is the case how can those same laws naturally guide the building of cellular life let alone the whole organisms
They have to be guided down the different regulated pathways if they are to succeed.
So whatever life is, it is certainly not a constituent part of physics or chemistry.

That is why a naturalist view of the origin of life is scientifically untenable.

That is also why NASA has been forced to draw the conclusion it has.

If any organisation needed a natural explanation to life’s origin it is they. Just think of all the funding they would receive if they could. There is every incentive for them to prove that they have conquered the problem of Abiogenesis, and if they were able to then I will let you speculate on the news headlines!!

xxxx

And you said: “… if you truly believe you’re onto something, make the most of it and stick to the proper method of conducting science.”

There is no climate for the proper method of conducting science as the supreme goals of the founding fathers, in the Illuminist Movement: science for the search of knowledge about the meaning of existence (against the meaning sold by the church). There is no funding for such enterprise.

First of all, we should go back to Oparin and Stanley/Urey experiment. Why those amino acids do not realize the next step in the lab, becoming proteins and RNA? What is missing in the Urey ingredients? What are determining, in this primordial soup, that life is only left-handed?

Second: We need to fall under the logic that the first complete biological system appeared in a given state of the world. If we bet that there are no supernatural causes, and we are not seeing links between the state of the world and biological systems, we need to understand that our theoretical models of the world are not right (mainly our cosmological models).

I am trying to return to the goals of the founding fathers. The result today is the Matrix/DNA Theory models. It is a suggestion of what is missing in the Urey ingredients. I am making the most of it and sticking to the proper method of conducting naturalism. I am sure nobody has proved facts for debunking the models. But, the deviation of scientific method is too big that the brains today are hard-wired for to escape from a different viewpoint and a return to the thru naturalism.

Um Software Feito de Luz! Qualquer raio spectral de Luz contem a fórmula/software da Matrix/DNA!

quinta-feira, setembro 22nd, 2011

xxxx

Luz Propagando o Ciclo Vital

Próximo artigo, sendo montado.

Surprêsa: A pequena larva dança hipnotizando o grande anfíbio, e o come. E a Matrix/DNA tem a unica explicação!

quinta-feira, setembro 22nd, 2011

A noticia saiu no…
WIRED Magazine
http://www.wired.com/wiredscience/2011/09/epomis-beetle-amphibians/

Baby Beetle Uses Mouth to Lure Amphibians to Their Doom

By Dave Mosher September 22, 2011 | 8:48 am | Categories: Animals

Larvas são as formas infantis de borboletas, besouros, etc. E são as prêsas, o alimento preferido dos anfíbios, que atuam como predadores, tais como as rãs, sapos, etc. Portanto esta deveria ser a regra lógica – o grande comer o menor – e nesta lógica tem acreditado a Ciência Acadêmica, apesar dos modêlos da Matrix/DNA Teoria terem sugerido outra lógica: o mais complexo come o menos complexo, tamanho não é o determinante.

As unicas ocorrências que a Ciência tinha captado até agora em que pequenos comem maiores eram nos casos de ataque em massa dos pequenos (como os virus dentro do corpo, ou enxame de abelhas atacando um animal maior ). Mas agora filmaram um caso que configuram como excessão, onde o grande predador cerca a pequena prêsa para comê-la, mas ela dança com suas antenas e o domina, comendo-o em seguida! Confirma-se assim mais uma previsão dos modêlos da Matrix/DNA, os quais sugerem e mostram muitos outros casos onde essa regra ocorre.

A noticia em WIRED termina com a seguinte frase:

Wizen and Gasith described the strategy of Epopmis beetle larvae as an “extremely rare anti-predator behavior.”
“How a single insect genus evolved a unique role reversal … is currently an enigma,” they wrote in the study.

Pois não se trata de uma unica tática reversa e não é um enigma, como explica o comentário abaixo que postei na WIRED:

TheMatrixDNA:

Only the explanation from Matrix/DNA Theory makes sense about this phenomenon. Evolution propagates by waves, circular and concentric waves. As the circular waves in water, the last wave transfers to the next one its dusty, the last wave of evolution transfer to the next its information. Each new wave then, adds its novelty, new informations, because it reached a most larger and rich environment. Then, beetles must be more evolved than anphibians, they are product of last waves. If life came from the water or from the beach, anphibians were the first landlives. The most complexity of beetles help them to be more technologically evolved. That’s it. Size does’nt matter.

It is not the rule the big eating the smaller. The rule is the most complex, most evolved, eating the less one. This rule came from the systemic life’s cycle: a human adult (most complex) “eat” the children (less complex) he was in the past;, a pulsar “eats” the planet it went on the past. And the life’s cycle already was encrypted on any spectrum of light, since the begining of the Universe, as we can see in the Matrix/DNA models.

xxxxxxxxxx
(obs. – Acompanhar tambem comentário postado em Richard Dawkins.net :

http://richarddawkins.net/articles/643201-baby-beetle-uses-mouth-to-lure-amphibians-to-their-doom?page=1

Porque e Para que Existem Formas de Vida Separadas no Universo e Como será nossa Conexão

quinta-feira, setembro 22nd, 2011

Para entender isso é preciso fazer uma analogia com o DNA. Afinal de contas, o código da vida na Terra veio e surgiu no Universo, então porque não seria nossa versão da vida no inteiro Universo? O DNA apresenta quase 98% de áreas que parecem não terem serventia. São imensas regiões de bases repetidas ou aleatórias, como AAAAAAAAAAGTCCCCCCCAAAAAA… Chamam essas áreas de DNA-Lixo. Agora pensem no Cosmos, as vastas regiões de estrêlas e galaxias como se espalhadas aleatóriamente. São estas vastas regiões estruturais repetitivas que representa o DNA-Lixo.

No meio destas regiões do DNA existem como que ilhas, de grupos de genes ativos. Num processo de reprodução, quando os genes constróem um novo corpo humano, em cada ilha, cada grupo tem a função de construir um órgão. Uns vão fazer o fígado, outros o coração, outros o cérebro, outros os olhos, o nariz, etc. Enquanto estão no começo, os genes de uma ilha não tem porque se comunicarem com outras ilhas. Quando o novo ser começa a tomar forma, saindo da fase de blastula, formando os inicios do feto, tem inicio alguma aproximação, algum cruzamento, entre genes de diferentes ilhas, pois tambem começam-se a definir os canais, estruturas que vão ligar os órgãos entre si.

Mas todo este enredo não acontece apenas com nosso DNA em nossa reprodução. Todo esse quadro e enredo é agora ampliado ao tamanho do Universo. Existem seres na galaxia Via Láctea, mais exatamente no planeta Terra e eles são genes construindo um órgão de um futuro corpo. Ao mesmo tempo, em várias outras galaxias existem grupos de seres construindo outros órgãos, mas todos para um mesmo futuro corpo.

Que corpo é êsse, qual será sua forma, sua substância?

Os corpos dos bebes humanos são da mesma substancia dos corpos dos genes. Digamos… matéria biológica. Mas quem está construindo o bebê cósmico não são os humanos na Terra, nem os orionenses em Orion, etc.. Quem o está constriuindo é a consciência que existe nos corpos destas criaturas. Assim como os genes biológicos não têm a menor idéia de que estão fazendo um corpo humano, assim tambem estas consciências não percebem ainda o que estão fazendo, porque existem. Mas por serem genes-consciência, logo que os órgãos começam a tomar forma começam a perceber o significado de sua existência, como estamos percebendo agora. Os órgãos dêsse bebê mental, mal saindo agora da forma da blastula, estão tomando forma, mas se constituem, por enquanto, no consciente coletivo de cada grupo de seres. Aqui na Terra por exemplo a forma atual é como um anel meio esvoaçado, a camada do consciente coletivo que circunda o planeta rente ao solo.

É um corpo mental, holográfico se assim prefere, da mesma substancia da nossa mente. Sua definição será algo como “A Consciência do Universo de Sua Própria Existência”. Mas êsse corpo mental não será algo disforme como uma nuvem, nem algo como uma esfera chamejante. Ele terá uma forma funcional, a forma de um sistema, tal como nosso corpo carnal tem a forma e funciona como um sistema. Observe o sistema desenhado na forma de diagrama/software da Matrix/DNA. Essa forma serviu como template, lay-out, para todos os sistemas naturais materiais, mas assim como os sistemas naturais evoluíram, desde átomos a corpos humanos, assim tambem a fórmula da Matrix está sob evolução, ainda. Esta é uma forma evolucionaria provisória. Não sabemos como será a forma final da Matrix, por isso não podemos saber da forma final do corpo mental.

É preciso lembrar ainda algo de suprema importancia. Sabemos que quem estava no meio daquela sôpa amôrfa que era a mórula no inicio do nosso corpo, eram os genes. Os quais compunham o que denominamos “genoma”. Mas o genoma surgiu ou têve origem na mórula? Dentro do saco embrionario? Não, ele existia a muito tempo antes de iniciar a formação do saco embrionario. Veio de nossos pais? Não, ele já exisxtia antes deles. De nossos avós? Não, pois pelo que se sabe na Terra as moléculas de RNA/DNA começaram a bilhões de anos. E se a fórmula da Matrix/DNA estiver correta, eles foram montados biologicamente aqui vindo na forma de fotons que compunham o DNA da galaxia. Surgiram então na galaxia? A fórmula já os detectou antes, como vórtices quanticos pipocando no momento do Big Bang, da fecundação universal. Assim como o genoma em nosso corpo hoje não teve origem dentro do nosso pequeno universo embrionario que era o saco amniótico, ele tambem não teve origem neste Universo.

Porem, quando terminam de fazer um corpo, para onde vão os genes que o construiram? Morrem? Desaparecem? Sabemos que todos os dias tem células nossas morrendo e sendo substituídas por novas. Então todo dia morre um individual DNA e é substituido por nova cópia dêle mesmo. O DNA individual que morreu, acabou-se o mundo para êle? Então os genes dêle existiram como meros escravos uteis, usados para fazer um corpo e depois descartados?

Com nosso cérebro é diferente. Ali tem um amontoado de células que são feitas nos primeiros dias do corpo e se mantem vivas durante toda a vida do corpo. Então todos os genes que participaram da construção do corpo, quando este está pronto se encontram no cérebro, como mente diretora do corpo. Todos tornam-se num só, individuo. Aquêles que morreram nas demais células não foram os iniciais que participaram na construção do corpo final, assim como os demais animais na Terra que não possuem consciência não participam da construção do corpo mental.

Assim será com todas as formas de consciencias espalhadas no Universo hoje: todas reunidas num só corpo, um só bebê, um só ser que um dia não acreditará se lhe disserem que no principio êle era separado em bilhões de cópias dêle mesmo, como você agora tambem não admite isso. Um ser que nascerá no dia do Big Birth, para um mundo externo alem deste Universo. Onde provavelmente tenha alguem nos esperando com ansiedade e braços abertos para nos abraçar. Quer dizer,… para me abraçar, ou melhor,… para te abraçar… mas te abraçando estará me abraçando porque seremos um só… (raios, está dificil resolver isto…)

Portanto, não temam as outras formas de consciência que vanos começar a contactar em breve. Tem gente que está com mêdo: “Será que, se forem mais poderosos que nós,vão nos eliminar, ou escravisar?”

Os tempos de evolução dos órgãos de um novo corpo são iguais em todos os lugares, claro. Quando começar os contactos, siginificará que os órgãos estão em adiantado estado de construção, já se começam a formarem os canais de conexão, e assim como nós já teremos consciência da nossa missão e da missão dêles, eles certamente tambem já terão captado quem somos e qual nossa missão. Nenhuma raça-animal sem consciência, nem alguma hipotética inteligencia perversa de órgãos que estariam atrasados, virá aqui, nem poderia ser mais poderosa que nós, pois estamos dentro do tempo avançado da evolução em que já começamos a perceber o significado da existência. Todos os conscientes sabemos que temos de formar uma equipe de trabalho em conjunto. Afinal, nem nós, nem eles, seriam tão estupidos para eliminar ou sequer atrapalhar o trabalho de quem vai fazer nosso próprio nariz. Ninguem quer nascer aleijado. Por isso, os que fazem o cérebro sabem que não são mais importantes que os que fazem o dedão do pé.

Estou ansioso para iniciar logo êstes contactos, mas esta ansiedade não é lógica. Eu sou já uma consciência, o que significa que não sou um simples gene, mas o genoma. E para o genoma o tempo não é o tempo humano, êle se conta em anos-luz, que são muitos dos nossos anos. Não sei ainda quanto falta para os ógãos serem aproximados, não sei ainda quantas vêzes vou mudar os turnos entre a feitura da massa e cimento aqui embaixo e a subida com êsse material para por no tôpo do edificio, mas o que importa é que a obra não vai parar, o que significa que os contactos acontecerão no seu devido tempo.