Porque e Para que Existem Formas de Vida Separadas no Universo e Como será nossa Conexão

Para entender isso é preciso fazer uma analogia com o DNA. Afinal de contas, o código da vida na Terra veio e surgiu no Universo, então porque não seria nossa versão da vida no inteiro Universo? O DNA apresenta quase 98% de áreas que parecem não terem serventia. São imensas regiões de bases repetidas ou aleatórias, como AAAAAAAAAAGTCCCCCCCAAAAAA… Chamam essas áreas de DNA-Lixo. Agora pensem no Cosmos, as vastas regiões de estrêlas e galaxias como se espalhadas aleatóriamente. São estas vastas regiões estruturais repetitivas que representa o DNA-Lixo.

No meio destas regiões do DNA existem como que ilhas, de grupos de genes ativos. Num processo de reprodução, quando os genes constróem um novo corpo humano, em cada ilha, cada grupo tem a função de construir um órgão. Uns vão fazer o fígado, outros o coração, outros o cérebro, outros os olhos, o nariz, etc. Enquanto estão no começo, os genes de uma ilha não tem porque se comunicarem com outras ilhas. Quando o novo ser começa a tomar forma, saindo da fase de blastula, formando os inicios do feto, tem inicio alguma aproximação, algum cruzamento, entre genes de diferentes ilhas, pois tambem começam-se a definir os canais, estruturas que vão ligar os órgãos entre si.

Mas todo este enredo não acontece apenas com nosso DNA em nossa reprodução. Todo esse quadro e enredo é agora ampliado ao tamanho do Universo. Existem seres na galaxia Via Láctea, mais exatamente no planeta Terra e eles são genes construindo um órgão de um futuro corpo. Ao mesmo tempo, em várias outras galaxias existem grupos de seres construindo outros órgãos, mas todos para um mesmo futuro corpo.

Que corpo é êsse, qual será sua forma, sua substância?

Os corpos dos bebes humanos são da mesma substancia dos corpos dos genes. Digamos… matéria biológica. Mas quem está construindo o bebê cósmico não são os humanos na Terra, nem os orionenses em Orion, etc.. Quem o está constriuindo é a consciência que existe nos corpos destas criaturas. Assim como os genes biológicos não têm a menor idéia de que estão fazendo um corpo humano, assim tambem estas consciências não percebem ainda o que estão fazendo, porque existem. Mas por serem genes-consciência, logo que os órgãos começam a tomar forma começam a perceber o significado de sua existência, como estamos percebendo agora. Os órgãos dêsse bebê mental, mal saindo agora da forma da blastula, estão tomando forma, mas se constituem, por enquanto, no consciente coletivo de cada grupo de seres. Aqui na Terra por exemplo a forma atual é como um anel meio esvoaçado, a camada do consciente coletivo que circunda o planeta rente ao solo.

É um corpo mental, holográfico se assim prefere, da mesma substancia da nossa mente. Sua definição será algo como “A Consciência do Universo de Sua Própria Existência”. Mas êsse corpo mental não será algo disforme como uma nuvem, nem algo como uma esfera chamejante. Ele terá uma forma funcional, a forma de um sistema, tal como nosso corpo carnal tem a forma e funciona como um sistema. Observe o sistema desenhado na forma de diagrama/software da Matrix/DNA. Essa forma serviu como template, lay-out, para todos os sistemas naturais materiais, mas assim como os sistemas naturais evoluíram, desde átomos a corpos humanos, assim tambem a fórmula da Matrix está sob evolução, ainda. Esta é uma forma evolucionaria provisória. Não sabemos como será a forma final da Matrix, por isso não podemos saber da forma final do corpo mental.

É preciso lembrar ainda algo de suprema importancia. Sabemos que quem estava no meio daquela sôpa amôrfa que era a mórula no inicio do nosso corpo, eram os genes. Os quais compunham o que denominamos “genoma”. Mas o genoma surgiu ou têve origem na mórula? Dentro do saco embrionario? Não, ele existia a muito tempo antes de iniciar a formação do saco embrionario. Veio de nossos pais? Não, ele já exisxtia antes deles. De nossos avós? Não, pois pelo que se sabe na Terra as moléculas de RNA/DNA começaram a bilhões de anos. E se a fórmula da Matrix/DNA estiver correta, eles foram montados biologicamente aqui vindo na forma de fotons que compunham o DNA da galaxia. Surgiram então na galaxia? A fórmula já os detectou antes, como vórtices quanticos pipocando no momento do Big Bang, da fecundação universal. Assim como o genoma em nosso corpo hoje não teve origem dentro do nosso pequeno universo embrionario que era o saco amniótico, ele tambem não teve origem neste Universo.

Porem, quando terminam de fazer um corpo, para onde vão os genes que o construiram? Morrem? Desaparecem? Sabemos que todos os dias tem células nossas morrendo e sendo substituídas por novas. Então todo dia morre um individual DNA e é substituido por nova cópia dêle mesmo. O DNA individual que morreu, acabou-se o mundo para êle? Então os genes dêle existiram como meros escravos uteis, usados para fazer um corpo e depois descartados?

Com nosso cérebro é diferente. Ali tem um amontoado de células que são feitas nos primeiros dias do corpo e se mantem vivas durante toda a vida do corpo. Então todos os genes que participaram da construção do corpo, quando este está pronto se encontram no cérebro, como mente diretora do corpo. Todos tornam-se num só, individuo. Aquêles que morreram nas demais células não foram os iniciais que participaram na construção do corpo final, assim como os demais animais na Terra que não possuem consciência não participam da construção do corpo mental.

Assim será com todas as formas de consciencias espalhadas no Universo hoje: todas reunidas num só corpo, um só bebê, um só ser que um dia não acreditará se lhe disserem que no principio êle era separado em bilhões de cópias dêle mesmo, como você agora tambem não admite isso. Um ser que nascerá no dia do Big Birth, para um mundo externo alem deste Universo. Onde provavelmente tenha alguem nos esperando com ansiedade e braços abertos para nos abraçar. Quer dizer,… para me abraçar, ou melhor,… para te abraçar… mas te abraçando estará me abraçando porque seremos um só… (raios, está dificil resolver isto…)

Portanto, não temam as outras formas de consciência que vanos começar a contactar em breve. Tem gente que está com mêdo: “Será que, se forem mais poderosos que nós,vão nos eliminar, ou escravisar?”

Os tempos de evolução dos órgãos de um novo corpo são iguais em todos os lugares, claro. Quando começar os contactos, siginificará que os órgãos estão em adiantado estado de construção, já se começam a formarem os canais de conexão, e assim como nós já teremos consciência da nossa missão e da missão dêles, eles certamente tambem já terão captado quem somos e qual nossa missão. Nenhuma raça-animal sem consciência, nem alguma hipotética inteligencia perversa de órgãos que estariam atrasados, virá aqui, nem poderia ser mais poderosa que nós, pois estamos dentro do tempo avançado da evolução em que já começamos a perceber o significado da existência. Todos os conscientes sabemos que temos de formar uma equipe de trabalho em conjunto. Afinal, nem nós, nem eles, seriam tão estupidos para eliminar ou sequer atrapalhar o trabalho de quem vai fazer nosso próprio nariz. Ninguem quer nascer aleijado. Por isso, os que fazem o cérebro sabem que não são mais importantes que os que fazem o dedão do pé.

Estou ansioso para iniciar logo êstes contactos, mas esta ansiedade não é lógica. Eu sou já uma consciência, o que significa que não sou um simples gene, mas o genoma. E para o genoma o tempo não é o tempo humano, êle se conta em anos-luz, que são muitos dos nossos anos. Não sei ainda quanto falta para os ógãos serem aproximados, não sei ainda quantas vêzes vou mudar os turnos entre a feitura da massa e cimento aqui embaixo e a subida com êsse material para por no tôpo do edificio, mas o que importa é que a obra não vai parar, o que significa que os contactos acontecerão no seu devido tempo.

Tags: , , , ,