Archive for the ‘genes’ Category

A descoberta de uma super-enzima e sua relacao com a forca que controla a evolucao

sábado, setembro 17th, 2016

xxxx

Estou entrando numa nova dimensao da Natureza de importancia grandiosa. E o artigo copiado abaixo para ser pesquisado aqui em cada informacao, esta relacionado ao assunto.

Ainda nao fasso ideia de como seria nem o esboco dessa nova dimensao. Mas existem evidencias, ela e’ logica, esta escudada em parametro natural conhecido.

Quando na embriogenese esta sendo construido um novo ser, parece que existe algo como um commando de instrucoes invisivel no DNA coordenando as atividades dos genes. Parece um maestro dirigindo uma orquestra. Mas sao milhares de genes ( cerca de 30.000?), e cada qual tem uma informacao unica, especifica dele. Entao seria uma orquestra com 30.000 musicos mas cada um tem um instrument unico, especifico, que emite um som diferente de todos os outros. O maestro coordena de maneira que cada instrumento entre num dado momento, e que em cada momento existe um grupo selecionado tocando. O gene que tem informacao para fazer algo do nariz ja estara a postos no momento seguinte a fecundacao, como todos os demais, mas ele tera que esperar inativo, sem se expressar, ate que os outros genes fassam a cabeca. E o artigo abaixo sugere como e’ compost o commando de instrucoes (o maestro) do DNA. Enzimas catalizadoras.

Sim, mas onde esta a nova dimensao do conhecimento? Como escrevi num artigo aqui ontem, as vidas dos humanos estao sendo “controladas” a nivel de Humanidade, de sistemas sociais, ou talvez mesmo a nivel inconsciente, por um semlhante invisivel e desconhecido commando de instrucoes.nao apenas a vida dos humanos, mas sim, a evolucao biologica de bilhoes de anos tem sido dirigida por esse comando misterioso. E as regras sao as mesmas que ocorrem com os genes. Isso cheira `a metafisica, ‘e quase impossivel, mas uma serie de detalhes me levam a suspeitar que isso nao apenas seria possivel, como de fato, deve estar ocorrendo.

Uma das possibilidades seria explicada por outra sub-teoria dentro da geral teoria da Matrix/DNA: a de que os 8 bilhoes de humanos sao 8 bilhoes de genes inconscientes cada qual carregando em suas cabecas uma particular de informacao unica, especifica, diferente de todas as demais, na forma de sua mente, construindo aqui uma nova forma do sistema natural universal, a qual denominamos ” auto-consciencia”. Se isto for verdade, tem que ter um commando central invisivel tal como tem no DNA.

Mas tem outra situacao, uma quase identica situacao. A teoria geral da Matrix/DNA esta sugerindo que, em paralelo a esta funcao de genes para uma auto-consciencia, tambem somos genes cnstruindo uma replica do nosso criador imediato e ancestral sistema astronomico. uer dizer, nao apenas os humanos, mas sim todos os sistemas biologicos dessa biosfera. Seriam duas tendencias conflitantes entre si, uma imediatamente materialista, obedecendo a evolucao de um hardware que vem se complexificando desde o Big Bang, e a outra, apesar de ser perfeitamente natural tambem, tem uma conotacao mais metafisica, pois estariamos construindo uma reproducao de algo que jaz alem deste Universo. Neste caso, o maestro seria inimaginavel por nos.

No roteiro da nossa evolucao era imprescindivel que o homem descobrisse como fazer o fogo, para dai fazer os metais e sua tecnologia. Coube a uma lendasugerir como isso ocorreu, metaforicamente falando, claro. Ptometeu condenado junto com Sisifoa rolar uma pedra morro acima ate que conseguissem coloca-la no pico do Monte Olimpo. A certo momento Prometeu desiste de rolar a pedra e ao inves vai furtivamente pelo lado escuro da montanha, sobe-a, alcanca o pico, e nao tendo mais o que fazer ali, rouba a tocha do fogo do trono de Zeus. teria chegado o momento certo do maestro mandar o gene para fogo entrar em acao. Nao poderia ter sido antes porque a humanidade nao estava preparada e nao podia ser muito tarde porque a humanidade poderia sucumbir antes. Seja como for, as enzimas catalizadoras fazem jutamente isso com os genes na embriogenese.

E seja como for, ja esperando que va perder meu tempo e de em nada, eu vou procurar se existe um maestro oculto  e quais suas forssas catalizadoras atuando sobre o conjunto da humanidade. nao espero encontrar o maestro relacionado a reproducao da auto-consciencia, pois isto seria muita pretensao, porem, se houver um maestro dirifgindo a reproducao da galaxia a nivel biologico, nos podemos encontra-lo. E esta super-enzima mencionada neste artigo sera uma das pistas a serem investigadas.

(obs:v oltar ao artigo da phys.org e ver varios outros artigos relacionados a este tema)

http://m.phys.org/news/2016-09-scientists-super-enzyme-dna.html

 Scientists discover how ‘super enzyme’ speeds up DNA repair

September 5, 2016
Credit: Medical Research Council

Scientists from the University of Sussex have discovered how an enzyme, known as PARP3, helps to accelerate the repair of DNA.

In the body, mutations can arise from DNA damage that is not repaired properly, leading to disease, including cancer and neurodegenerative disease. New research funded by the MRC and Cancer Research UK, led by the laboratories of Professor Keith Caldecott and Professor Laurence Pearl at the University of Sussex’s Genome Damage and Stability Centre, has identified how the PARP3, short for poly(ADP-ribose) polymerase 3, recognises and signals the presence of broken DNA strands.

Research has shown that the PARP3 enzyme is involved in the DNA repair process and helps to maintain the integrity of the genetic code, but until now the precise DNA repair activation mechanism triggered by the enzyme was unclear.

Using multi-disciplinary expertise, Sussex scientists have identified the specific steps involved in activating the DNA repair process. When the PARP3 enzyme locates a specific site of DNA damage, it ‘marks’ the damaged DNA with a molecular signal.

This signal is created via a chemical change, involving the addition of a molecule called ‘ADP-ribose’ to the DNA. The DNA is packaged up in a complex called ‘chromatin’ which contains proteins; the team found that the PARP3 enzyme adds the ‘ADP-ribose’ molecule to one of these proteins – ‘histone H2B’.

By marking the precise site of damage the enzyme flags the problem up to specialised DNA repair enzymes that will move in to repair the damage, protecting the cell from potentially dangerous DNA breaks.

The researchers believe this is a vital step towards understanding how DNA breaks are detected, signalled, and repaired, which could in the future enable scientists to create drugs which can better target certain cancers.

PARP3 is one of a superfamily of enzymes that are targeted by PARP inhibitor drugs, a new class drugs used to treat hereditary cancer, including ovarian and breast cancer. Knowledge of how the PARP3 enzyme activates DNA repair will also contribute to improving the understanding, and targeting, of PARP inhibitor drugs.

The research, which took place over four years, also involved nuclear magnetic resonance expertise in Professor Steve Matthews’ group at Imperial College, London, proteomics in the lab of Dr Steve Sweet in Sussex and chromatin biology in the lab of Dr Alan Thorne at the University of Portsmouth.

Professor Keith Caldecott, who led the study, said: “This discovery highlights the value of multi-disciplinary collaborations, combining molecular and cellular biology with biochemistry and structural biology. As a result of working together, we have been able to identify how PARP3 recognises and flags the presence of broken DNA.

“This will be important for our understanding of how cells protect themselves from potentially dangerous DNA breaks. It will also help to provide insight into the mechanisms of action of a new class of PARP inhibitory anti-cancer drugs.”

Ver tambem este outro artigo relacionado ( mas estarei escrevendo outro artigo para isto pois se trata da origem da vida):

New knowledge about the building blocks of life

September 2, 2016

http://phys.org/news/2016-09-knowledge-blocks-life.html

Read more at: http://phys.org/news/2016-09-knowledge-blocks-life.html#jCp

Pesquisa:

PARP3, short for poly(ADP-ribose) polymerase 3

Enzyme (definicao em http://phys.org/tags/enzyme/

Enzymes are biomolecules that catalyze (i.e., increase the rates of) chemical reactions. Nearly all known enzymes are proteins. However, certain RNA molecules can be effective biocatalysts too. These RNA molecules have come to be known as ribozymes. In enzymatic reactions, the molecules at the beginning of the process are called substrates, and the enzyme converts them into different molecules, called the products. Almost all processes in a biological cell need enzymes to occur at significant rates. Since enzymes are selective for their substrates and speed up only a few reactions from among many possibilities, the set of enzymes made in a cell determines which metabolic pathways occur in that cell.Like all catalysts, enzymes work by lowering the activation energy (Ea or ΔG‡) for a reaction, thus dramatically increasing the rate of the reaction. Most enzyme reaction rates are millions of times faster than those of comparable un-catalyzed reactions. As with all catalysts, enzymes are not consumed by the reactions they catalyze, nor do they alter the equilibrium of these reactions. However, enzymes do differ from most other catalysts by being much more specific. Enzymes are known to catalyze about 4,000 biochemical reactions. A few RNA molecules called ribozymes catalyze reactions, with an important example being some parts of the ribosome. Synthetic molecules called artificial enzymes also display enzyme-like catalysis.Enzyme activity can be affected by other molecules. Inhibitors are molecules that decrease enzyme activity; activators are molecules that increase activity. Many drugs and poisons are enzyme inhibitors. Activity is also affected by temperature, chemical environment (e.g., pH), and the concentration of substrate. Some enzymes are used commercially, for example, in the synthesis of antibiotics. In addition, some household products use enzymes to speed up biochemical reactions (e.g., enzymes in biological washing powders break down protein or fat stains on clothes; enzymes in meat tenderizers break down proteins, making the meat easier to chew).

XXXXXX

Dados tecnicos e modelo deste gene no Genome Databank:

Human Gene PARP3 (ENST00000431474.5) Description and Page Index

http://genome.ucsc.edu/cgi-bin/hgGene?db=hg38&hgg_gene=PARP3

xxxxx

Wikipedia:

Poly [ADP-ribose] polymerase 3 is an enzyme that in humans is encoded by the PARP3 gene.

The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified.

Poly (ADP-ribose) polymerase (PARP) is a family of proteins involved in a number of cellular processes involving mainly DNA repair and programmed cell death. ( cont a ler)

 

 

 

Novas Questoes Sobre Genetica, DNA, Sendo Respondidas Apenas Por Matrix/DNA Theory

terça-feira, agosto 9th, 2016

xxxx

O Dr. Deepak Chopra e’ um conhecido aguerrido militante defendendo a esoterica teoria de que uma consciencia divina estaria por tras de nossas vidas e tudo que e’ fenomeno natural. Tao militante que participou de varios debates na midia – tv, magazines,videos, etc. – com cientistas ateus famosos. Ele combate veementemente o atual paradigma cientifico.

Pois bem, hoje ele postou mais um artigo em varias midias, defendendo suas ideias e cutucando os materialistas. Ele levanta interessantes questoes que passam despercebidas do meio intelectual, que os cientistas materialistas nunca pensam a respeito, por isso, estamos atentos aos seus artigos, apesar de diferir-mos tanto dele quanto do paradgma academico atual. Entao nao pude evitar publicar um comentario no seu artigo, o qual vai copiado abaixo. Vamos registrar o artigo aqui para anotar as importantes questoes que ele levanta e responde-las segundo o que sugere a formula da Matrix/DNA.

What Is Your DNA Doing For You Right Now?

http://www.huffingtonpost.com/deepak-chopra/what-is-your-dna-doing-fo_b_11388690.html

By Deepak Chopra, MD and Rudolph E. Tanzi, PhD – 08/08/2016

E meu comentario postado no artigo do Huffington Post:

Louis Charles Morelli – 08/09/2016

Mr. Deepak: About the bad things did by DNA – like creating monsters as snakes, lions, etc. – were it also produced by counciousness at the source?
I agree we need a paradigm shift towards reality but, reality is 50% good things and 50% bad things. So, counciosness would be 50% a good God and 50% a bad evil?
Yes, DNA can tell the time – if you are interpreting DNA as do the Matrix/DNA theoretical model of DNA, different from the academic paradigm. DNA is anything else than a pile of bilions copies with some small diferency of a universal formula that is encrypted into its building blocks – a lateral pair of nucleotides. Like Humanity is a set of 8 billions diversified copies of its building blocks: the individual human.
It happens that this formula is also encrypted into the building blocks of atoms, galaxies, everything that looks like a natural system. So, its is all about a working systemic fractal which is inside a bigger fractal which is inside another biggest fractal, stablishing the hierarchy of systems. Neither the building blocks of atoms, nor the ones of galaxies tells time, butwhen all them are based on th same working formula, all them obeys the same synchronized scallar time.
From the first day of fecundation to
its 7 month, there is no actions of counciusness building the fetus. But you know that is not each embryo creating consciouness for the first time in this Universe. Conciosness was existing outside the litte embryo’s universe and was existing as not expressed potential force at morulae, blastula, fetus shapes. Why conscuoenesswas not expressed at our ancestors systems, like atoms and galaxies? Fractals, Dr. Deepak. 7 months for a fractal called “human” is same time as 13,7 billion years counted by by the bigger fractal called “universe”.
We need a paradigm shift but to a real one, one that does not forget 50% of reality.
xxxxxxx
Pesquisa:

Deepak: “If every cell is a biological robot, and the entire body is made up of cells, then we must be biological robots too. This view, which a surprising number of geneticists believe in, cannot be true. It is a conclusion that the old model of DNA supported because that model was reductionist—that is, all complex processes can be explained by breaking them down into more basic processes. The whole approach is totally logical, but nobody can seriously claim that the works of Shakespeare and Mozart are explainable by protein manufacture. And in our daily lives we think thoughts and feel emotions, which proteins don’t, or cells for that matter.

As a result, genetics has been racing to catch up with human reality. On several fronts there has been progress, of a sort. So-called Systems Biology has emerged to examine how the body works as a dynamic, changing organism responding to input from the environment. In this way DNA stopped being so rigid and got into the game. On another front a field known as epigenetics began to study how everyday experience, including our lifestyle and memory, actually gets chemically imprinted on our genes. Again, DNA became more dynamic and responsive.

But while DNA was getting liberated, what was really happening? One could argue that the only thing changing was a scientific model. Reality wasn’t changing at all. Now it is dawning that DNA is fundamentally so mysterious, biology can’t even contain it, much less explain it.

Matrix/DNA: Ok, isto ja foi explicado pela Matrix.

Deepak: ( continuar isto)

Espaço Interestelar: Pesquisa Sobre Moléculas e Outros Componentes

sábado, janeiro 2nd, 2016

xxxxx

O que existe nos imensos espaços entre as estrelas, ou sistemas estelares, se a estrela conter planetas,etc.?!

Bem… alem da provável dark matter ( e dark energy?), as ciências astronômicas tem detectado grãos de poeira e moléculas. Então este assunto e’ de muita importância para a Matrix/DNA Theory porque… segundo esta teoria por estes espaços viajam os ” genes semi-vivos”, ou seja, os bits-informação do building block astronomico que produzem os building blocks dos sistemas biológicos, ou seja, da Vida.

Neste capitulo vamos armazenar a pesquisa deste assunto.

1) O link abaixo conduz a um interessante e resumido PDF:

Interstellar Molecules

( foi obtido a partir de: http://prospect.rsc.org/blogs/cw/wp-content/uploads/2015/12/Interstellar-Hydrogen-Bonding-Poster-.pdf

e de:  http://prospect.rsc.org/blogs/cw/2015/12/09/isacs18-poster-prize-winner-emmanuel-etim/#more-16567  )

2) Chemistry WorldBlog 

http://prospect.rsc.org/blogs/cw/2015/12/09/isacs18-poster-prize-winner-emmanuel-etim/#more-16567

ISACS18 poster prize winner: Emmanuel Etim

Posted by Jennifer on Wed 9 Dec 2015
Categories: Conferences | [14] Comments

Chemistry World was pleased to sponsor a poster prize at ISACS18 (Challenges in Organic Materials and Supramolecular Chemistry), held in Bangalore, India, last month. PhD student Emmanuel Etim from the Indian Institute of Science, India, was the winner with his poster titled: Interstellar hydrogen bonding.

Emmanuel Etim

Emmanuel explains his work:

‘We are interested in understanding the chemistry of interstellar molecules – ie molecules that exist in the space between the stars – because of their importance in astrochemistry, astrophysics, astrobiology, astronomy and related fie

Over 200 of these molecules have been detected in different astronomical sources largely via their rotational spectra. Isomerism is a conspicuous feature of these molecules with over 40% of the known molecules (excluding the diatomics and other special species like the C3, C5, which cannot form isomers) observed in more than one isomeric form.

But why are some isomers observed and others are not has been a question for decades. In addressing this question, we investigated 130 molecules from 31 isomeric groups and we found a unique relationship, which accounts for the detection of some isomers and the non-detection of others. According to the Energy, Stability and Abundance (ESA) relationship, interstellar abundances of related species are directly proportional to their stabilities. However, we observed some deviations from the ESA relationship in a few isomeric groups: Where the most stable isomers are not observed and where the most stable isomers are not the most abundant. What could be responsible for these deviations?

How are these molecules formed? Reactions that occur on the surfaces of interstellar dust particles have been invoked in the formation of molecular hydrogen; as well as for the synthesis of larger interstellar molecules. Water molecules constitute about 70% of the interstellar dust grains (interstellar ice). These water molecules serve as the platform for hydrogen bonding. This interstellar hydrogen bonding causes a greater portion of these molecules to be attached to the surface of the dust grains. This reduces the overall abundances of the molecules in the gas phase.

Our high level quantum chemical calculations for the hydrogen bond interaction between the interstellar molecules (known and possible) and water, shows a direct correlation between the binding energies of these complexes and the abundances of the interstellar molecules. This accounts for the observed deviations from the ESA relationship.

From both ESA relationship and interstellar hydrogen bonding, we predicted ketenes as potential candidates for astronomical observation. In line with this, ketenyl radical has just been observed in space.

Finally, the weakly bound complexes that are formed in the interstellar medium (ISM), are they detectable? The conditions in the terrestrial laboratories where weakly bound complexes are observed are similar to the conditions in ISM and the high binding energies of the complexes imply that these complexes are detectable in ISM.’

xxxx

Postei o seguinte comentário no Chemistry world blog:

 

Horizontal Gene Transfer (HGT) Foi Previsto Pela Matrix/DNA há 30 Anos Atrás

sábado, abril 11th, 2015

xxxx

No meio acadêmico sempre se pensou que não teria como passar genes de uma espécie para outra com a qual ela não se cruza. Mas ainda na selva há 30 anos atrás descobri uma fórmula para sistemas naturais pela qual, em dadas circunstancias como foi o evento das origens da vida na Terra, informações não apenas podem como devem passar de um sistema a outro. E isto incluía os sistemas naturais denominados seres vivos. tempos depois o meio acadêmico descobriu o fenômeno da transferência horizontal de genes, ou seja, alem dos genes serem passados de gerações a gerações, verticalmente, eles tambem se movem entre os genomas de distantes espécies. Exemplos incluem a absorção de bactéria por outra espécie ( isto foi como a mitocondria foi originada, uma teoria sugerida por Lynn Margulis; e estas mitocondrias, que eram antes bacterias livres, contribuiram com seus genes para os absorventes organismos); a transferencia de genes pigmentais de fungos para afídeos, os quais deram aos afídeos a cor  vermelha que muito os ajudam a se esconderem dos predadores; e a transferencia de várias enzimas de bactérias para insetos, as quais ajudaram os insetos a usarem novas plantas como alimento.

Segundo a história da evolução sugerida pela Matrix/DNA, as sementes da vida espalhadas largamente no Cosmos não são transmitidas para superfícies de planetas encerradas em um envoltório como são os genomas biológicos contidos dentro de uma membrana. Espermatozóides e óvulos são transmitidos completos e por inteiro, por isso só podem gerar uma forma de ser vivo, a forma da espécie emissora. Mas o primeiro “genoma” não  veio de um sistema biológico como os seres vivos na Terra, e sim do sistema astronomico ao qual a Terra pertence. Este genoma é liberado pela radiação de energia de estrelas como o Sol e pela radiação dos núcleos de planetas como a Terra, mas são fragmentados em seus menores bits-informação no espaço sideral e através de longos  tempos. Vizinhos fragmentos que se encontram em um ponto na superfície de um planeta se juntam em pequenos pacotes de informações, depois estes pacotes se juntam a outros pacotes, e como são pedaços de um sistema vivo, podem funcionar como pequenos pacotes, sendo esta a causa da grande diversidade da vida na Terra. Muitos pacotes apresentam brechas, lacunas, em seus DNA’s, as quais podem serem preenchidas se houver contacto com outro DNA ou RNA que contenha aquelas informações faltantes.  A fórmula da Matrix/DNA sugeriu que esta transferência horizontal de genes ocorreria em larga escala nas origens da vida e nas espécies mais simples, como nos procariotas unicelulares. Depois esta transferência se tornaria cada vez mais rara, porem podia perpassar todo o reino vegetal e animal até chegar no gorila, e isto porque a semente astronômica para sistemas biológicos só poderia gerar como ápice evolucionário uma maquina tão eficiente quanto a ancestral mas limitada a ela, o que não inclui os humanos. Com o genoma humano é ainda um sistema aberto, se houver HGT deve ser deléterio, piorando o genoma. Esta previsão vem ao encontro da teoria de alguns cientistas sugerindo que os alimentos transgênicos e outros tipos emparelhamento de genomas podem ser inclusive uma causa de canceres.

Muito tempo depois da selva, por volta do ano 2.ooo, tomei conhecimento que a primeira descoberta de HGT entre virus se deu em Seattle, em 1951; e em 1959 descobriu-se no Japão a HGT entre bactérias, o que era responsavel pela resistencia bacteriana aos antibióticos. Porem, a primeira suspeita de que HGT tambem estaria ocorrendo entre organismos complexos multicelulares ou eucariotas, data de 2005, anunciado por Bapteste et al., e se não me engano tambem por Lake e Rivera em 2007 quando disseram que “…adicional evidencias sugerem que a transferencia de genes pode tambem ser um importante mecanismo evolucionario na evolução dos protistas”.

A propósito, menciono aqui um artigo recente bem esclarecedor do tema:

 How often do genes move between distantly related species?

https://whyevolutionistrue.wordpress.com/2015/04/10/how-often-do-genes-move-between-distantly-related-species/#respond

E meu comentario postado naquele artigo ( o qual ninguem ali vai entender nada… mas… é meu dever fazê-lo): 

( Verificar se foi publicado). 

HGT from the RNA-world to gorillas was first suggested by the evolutionary model of Matrix/DNA Theory 30 years ago. The model suggests a formula containing all informations coming from the prebiotic world that works as sidereal seeds of life but alike biological genoma, these seeds are fragmented into its smallest bits-information which are spreaded in space and time. When these bits meets at any point that has the necessary conditions, like some planetary surfaces, they have the tendency of joining again in the equal sequence they were formed, making smaller packets of informations that can works as non-complete systems and this is the reason of diversity of life from a unique genoma. These packets maybe contains gaps due missing the right bits, which can be find at another packets, which produces HGT.  It must happens from initial organic molecules to gorillas, stopping here due gorillas are the evolutionary limit possible by those informations. If it happens with humans, like by transgenic food or meat consumption, HGT must be deleterious and the cause of several diseases, like cancer. At least, this is what is suggesting Matrix/DNA Theory.

Porque Humanos Desenvolveram Cérebro Diferente dos Macacos? Por um Êrro Genético!? A Ciência Oficial Diz que Sim e a Matrix/DNA Explica que Não.

domingo, março 1st, 2015

xxxx

Baseado no surpreendente artigo:

Xeroxed gene may have paved the way for large human brain

( Xerocado gene pode ter pavimentado o caminho para o grande cérebro humano)

http://news.sciencemag.org/biology/2015/02/xeroxed-gene-may-have-paved-way-large-human-brain

By   – 26 February 2015 2:00 pm

Comparação do tamanho de cérebros entre primatas. (Observe que a parte frontal em diferentes cores se refere ao córtex pré-frontal e foi onde se deu o maior avanço)

De lagartos a gorilas e chimpanzés, todas as espécies intermediarias deixaram de desenvolver um cérebro maior e talvez mais inteligente como o humano, simplesmente porque eles tinham um gene que impedia esse desenvolvimento. Então, dentre os chimpanzés ocorreu uma divisão na espécie, uma continuando a ser os velhos chimpanzés e a outra – os Denisovans – se desenvolveram em Neandertais. Nesse meio tempo, aquele gene indevido desapareceu e no seu lugar surgiu um novo gene que começou a produzir muitas novas camadas inferiores de células cerebrais. Estas camadas se parecem  como aquelas fundações ou alicerces que fazemos na terra para depois construir os edifícios em cima. Assim, sobre as novas camadas surgiam novos grupos de neurônios, como edifícios. A cidade cresceu, quer dizer, o cérebro cresceu. E assim do Neanderthal  se desenvolveu o humano atual, enquanto a linhagem dos velhos chimpanzés continuam do mesmo  jeito com seu gene trapalhão.

Mas porque e como da espécie dos chimpanzés saiu uma nova espécie? Bem,… tem aquela história da mutação  ou clivagem do cromossoma 23, ou 24, se me lembro bem. E qual era a principal diferença entre os chimpanzés e a nova espécie dos Denisovans?

A principal diferença foi que a espécie saída dos chimpanzés era os “cabeções”, pois tinham o cérebro maior. E isto porque um gene em alguns indivíduos da velha espécie dos chimpanzés não conseguiu fazer uma cópia completa dele mesmo. Com isto, um outro gene, denominado ARHGAP11B, apareceu na genética dos Denisovans e alavancou o crescimento do cérebro! Nem lagartos, nem ratos, nem chimpanzés possuíam o tal do ARHGAP11B, mas este gene foi encontrado apenas nesta linhagem que saiu dos macacos e chegou nos humanos.

Bem… isso é o que esta noticia – publicada pela conceituada e insuspeitada Science, da AAAS.ORG – estonteante nos revela. Pelo meu fraco entendimento de leigo, entendi que um casual erro de leitura e duplicação por algumas enzimas, inventou nada mais, nada menos, que os… humanos!!! Em outras palavras, somos uma aberração descabida na Natureza! Ou seja: seres inteligentes e dotados de auto-consciência são aberrações naturais… causadas por mal-função dos elementos e fôrças naturais.

Mas isto vai mais longe – sempre segundo minha leiga opinião : Como um acidente é impossível de ocorrer duas vezes exatamente iguais ( pois se isto  acontecer não é mais acidente, e sim eventos padrões normais na Natureza, isto deve significar que em nenhum outro lugar do Universo e do mundo existiu, existe, ou existirá outros seres inteligentes dotados de auto-consciência!

Estou certo ou errado no meu raciocínio? Se errado… onde e porque errei?

E por todas cargas d’água… me recuso a aceitar que aquele tenha sido um erro natural. Sou teimoso, ignorante,mula empacada, mas não me curvo às evidencias descobertas e comprovadas pelos cientistas. Principalmente porque a minha incomum e inédita visão do  mundo que inclui a determinante fórmula natural da Matrix/DNA me  trás da memória um evento evolucionario ocorrido nas origens da Vida que as demais visões de mundo, inclusive a que domina o  maio cientifico e acadêmico hoje, não fizeram o mesmo arrancando aquele evento da memória, na hora de interpretar o que ocorreu com os velhos chimpanzés. Me refiro a quando no mundo dominava a célula vegetal e nela houve uma mutação cujos novos indivíduos mutados se tornaram as células animais. Vejo aí nos dois casos o mesmo mecanismo, o mesmo processo, e um propósito pré-determinado pela evolução. Se um evento se repete igual ao menos duas vêzes, quer dizer que não é um êrro acidental, e sim um padrão, um evento obrigatório quando se apresentam determinadas circunstancias.

A fórmula da Matrix/DNA sugere que a divisão da velha célula vegetal se deu porque ela se constituiu em sistema fechado em si mesma. E quando isso ocorre ou a Natureza retira a espécie do tronco da árvore da evolução, descartando-a, levando-a constituir um galho lateral, e apenas deixando-a existir por um tempo enquanto não atrapalha muito ou é útil aos demais elementos situados ainda no tronco. Enquanto isso a Natureza retorna no tempo evolucionário do tronco encontrando uma espécie anterior ao descartado que ainda era um sistema aberto, e por ali continua a evolução. Dentre os macacos o que tem o corpo como a mais perfeita e poderosa máquina não é o do chimpanzé, e sim do gorila. Mas como podemos ver no gráfico acima, os gorilas possuem o cérebro menor que o chimpanzé, e a julgar pelo que veio depois, concluímos que o gorila se encaminhou por  caminhos errados ( a maior facilidade na vida os acomodou, levando-os a se tornarem um sistema fechado, e apenas desenvolveram o corpo baixo ao invés do cérebro – como estão fazendo a maioria da juventude humana agora lutando desesperadamente nas academias de modelação física enquanto não dedicam tempo e mente para a busca do conhecimento intelectual… e se continuarem assim… tambem serão os inferiores no futuro até serem tambem descartados). Os chimpanzés inferiores ao tamanho dos gorilas tiveram que continuar a forçar o cérebro em novas maneiras de competir e sobreviver aos gorilas e com isso aumentaram um pouco o tamanho de seus cérebros. Mas basta ver um vídeo que corre pela Internet de um bando de chimpanzés atacando, trucidando e comendo macacos espécies de macacos menores, e deduzir que os gorilas começaram a  diminuir em numero porque já estavam condenados,para concluir que numa certa época os chimps dominaram. E novamente os vivos caíram na eterna armadilha… parando de desenvolver o cérebro e obrigando a natureza a forçar uma nova divisão no tronco da árvore da evolução. Então essa interpretação cientifica materialista de evolução por erros acidentais peca pelo vicio do reducionismo, onde as mais amplos horizontes no tempo e no espaço de onde se vê a macro-evolução universal é reduzida ao limitado tempo e espaço da evolução biológica e com isso a muitos equívocos sobre como realmente a Natureza funciona.

De ratos a chimpanzés havia um gene X. A linhagem dos humanos saída dos chimpanzés não tem mais o gene X.  O gene X não existe em nós porque um primitivo humano não conseguiu copia-lo completo. Isto é fato, comprovado pelos cientistas. Não posso duvidar e muito menos negar esse fato.

De ratos a chimpanzés nunca houve o gene Y. A linhagem dos humanos saída dos chimpanzés conseguiu produzir o gene Y (ou melhor, o tal ARHGAP11B ). O gene Y atua no desenvolvimento embrionário produzindo muitos novos neurônios, o que faz o cérebro ser o maior existente na Terra. Isto é fato comprovado pelos cientistas. 

Então como não aceitar a “verdade” que os cientistas tiveram que engolir e aceitar? Sou algum débil mental? ( eu acho  que não em relação aos humanos, mas certamente sou ou serei um débil mental se comparado com os cérebros humanos do futuro, ou com possíveis seres existentes em outros mundos e mais evoluídos).

Eu continuo a suspeitar que a verdade que salta aos olhos dos cientistas não seja a “verdade ultima” porque eu suspeito que exista a fórmula da Matrix/DNA, para sistemas naturais. E se ela existe de fato, o evento em que aquele gene não conseguiu se duplicar corretamente, foi devido a ação sutil da fórmula. Sutil, demorada, lenta, mas inevitável. Trata-se da fórmula para todos os sistemas naturais, o cérebro é em si, isolado do resto do corpo, um sistema natural. Ele esteve incompleto durante toda a história evolucionaria da forma biológica dos sistemas naturais, e devido a alguns indícios, continua ainda incompleto como sistema, nos humanos. Não foi um erro, não foi um acidente casual, foi o acêrto que continua acertando.

Genes são pacotes de nucleotídeos. Nucleotídeos são pedaços bi-laterais do DNA que se tornam uma unidade fundamental de informação quando se juntam seis nucleotídeos, três pares laterais e formam um códon. Cada unidade de informação é, em si mesma um sistema natural completo e funcional. Desde que este sistema natural chamado códon pode se dividir em bilhões de indivíduos diferenciados entre si ( assim como a espécie humana é uma só forma, porem dividida em 8 bilhões de cópias onde todas diferem entre si em algum minimo detalhe que seja), cada gene é um pacote de cópias diferenciadas entre si ( assim como numa fábrica, cada grupo de trabalhadores faz uma especifica tarefa).

Então cada gene como pacote é um sistema natural em si mesmo, derivado e evoluído a partir do sistema dos pacotes menores dos nucleotídeos. A soma de todos os genes-sistemas chama-se DNA ( com mais um pouquinho de lixo no meio, que na verdade, não é lixo). O qual em si é um grande pacote, mas tambem, um sistema, na mesma linha dos sistemas anteriores. Ora, como podemos ver na fórmula universal para sistemas naturais, enquanto qualquer sistema estiver se formando, ocorrem competições entre suas partes, com algumas querendo mais privilégios, alimentos, etc., que as outras partes, e de fato, algumas partes crescem demasiado e dominam o sistema em formação. Como cada parte representa uma função sistêmica, então o que ocorre é uma dominância de expressão de uma função. Isto ocorreu quando as primeiras células-sistemas eram apenas vegetais. A função sistêmica numero 7, que era representada pelo cloroplasto, dominou a célula, se conectou direto com o Sol e surgiu a fotossíntese, o que tornou essa dupla célula+estrela um sistema fechado em si mesmo, porta fechada para a evolução. Mas nada nem ninguem interrompe a evolução para sempre, então numa nova célula os genes para função 7 não conseguiram se replicar por completo e desapareceram, dando origem a uma nova espécie de células, a célula animal… sem o cloroplasto. Porem a célula sem fazer síntese com o Sol tornou-se filha da necessidade, um sistema aberto, precisando mover-se e procurar outro alimento… mas é justamente através dos necessitados e não dos acomodados, que a evolução pode fluir. Ora… no ponto de vista de cientistas que desconhecem a história maior, a não cópia integral do gene para cloroplasto teria sido um erro, um acidente casual. A mesma história deve ter ocorrido na espécie dos chimpanzés. Eu já estou cansado de dizer aqui que, quando comparo o nosso ancestral astronomico com os corpos de todos os seres vivos, é o macaco, como gorilas, que parecem uma reprodução mais fiel daquele ancestral que o corpo humano. Pois aquele ancestral astronomico era e é a mais perfeita maquina já produzida pela Natureza, enquanto o corpo do gorila, do chimpanzé é a mais perfeita maquina dentro os biológicos. A partir daqueles macacos o corpo mamífero teve algumas involuções de órgãos básicos para a sobrevivência na biosfera. Aprendí isso a duras penas competindo com macacos por sete anos na selva amazônica… e apanhando mais que bumbum de moleque peralta. Essa involução produzindo um salto na evolução ocorreu ao menos duas vezes – nas células e nos macacos – portanto não é um evento ao acaso, é um padrão repetitivo.

Então vejamos como foi esse “erro” mágico que acabou inventando coisas como a mente e a auto-consciência. A antiga fábrica do Ford Modelo T ( que mais parecia uma carroça) não produziu mais o modelo T e agora produz o Lincoln ( por assim dizer). Os operários do grupo X que produzia a carroceria de madeira deram lugar a operários do grupo Y que produzem carrocerias com polietileno.  Foi um tremendo e acidental erro de engenharia? Não… foi a evolução simples e matreira se movendo por suas sendas naturais. Nada nem ninguem pode interrompê-la, muito menos um grupinho qualquer formado por cópias diversificadas de um sistema que veio das estrelas e chamado LUCA – the Last Universal Common Ancestor de todos os sistemas biológicos.

Segundo está sugerindo a Matrix/DNA, este Universo é um mero aglomerado de ancestrais nossos da espécie denominada “galáxia” e no qual está ocorrendo um mero processo de reprodução genética da coisa desconhecida que existia/e/ou existe ainda alem deste Universo.  Se aqui está aparecendo coisas como inteligencia, auto-consciência, e sabe-se mais o que vai aparecer por aí, é porque aquela coisa desconhecida já possuía ou possui estas coisas. Assim como um feto de humanos desenvolve um cérebro e nos seis ou 7 meses este cérebro está num estado evolutivo tal que pode manifestar os princípios da auto-consciência,porque a auto-consciência não foi inventada por cada embrião, mas sim veio de uma coisa que existia/existe alem do pequeno universo do embrião… assim a auto-consciência apareceu e terá de aparecer em muitos outros lugares diferentes deste Universo. Não foi um erro acidental que levou o meu estado embrionário a produzir a minha consciência… mas é possível que alguns alienígenas feitos de ferro e borracha e sem vida igual a nossa assistindo o desenvolvimento de um embrião num tubo de ensaio sem ver nenhum outro ser humano, vai acreditar que a emergência da auto-consciência se deu por um erro de transcrição no processo genético. Ora…

Pelo amor de Deus… parem de interpretar e crer em interpretações vendo apenas um pequeno instante e pequeno espaço da Natureza Universal. E com isso alimentando e reforçando cada vez mais esta visão de mundo materialista, nihilista, contrária à dignidade humana, afirmando que seríamos meras verrugas incongruentes que nada teria a fazer neste mundo.

Como sou teimoso como um burro empacado e continuo a suspeitar inclusive da teoria da Matrix/DNA, resta-me lembrar da maravilhosa cabeça grande e ainda mais amável auto-consciência da minha mãe e desejar ardentemente que o que os cientistas chamam de erros acidentais desse tipo continuem a ocorrerem… quanto mais melhor!

E ainda temos mais um problema. Sendo que esse “erro” ocorreu depois que uma nova espécie já havia se separado dos chimpanzés, então uma outra mutação anterior ocorreu nos próprios chimpanzés que levou à separação. Talvez seja imigração de um grupo para diferente território… ou talvez seja novamente outro erro de cópia genética. Então existem com certeza outros genes que os chimpanzés tem e nós não temos, e vice-versa. Precisamos encontra-los e quando isso ocorrer… talvez os cientistas comecem a vislumbrar a ação sutil da Matrix.

xxxx

A seguir copio o artigo em inglês para traduzi-lo em português, o que é bom para mim, pois escrever e copiar os artigos importantes tem sido ótimo para aprender mais e guardar os dados na memória:

Last week, researchers expanded the size of the mouse brain by giving rodents a piece of human DNA.

Na ultima semana, pesquisadores expandiram o tamanho do cérebro de ratos ao darem aos rodentes um pedaço do DNA humano.

Now another team has topped that feat, pinpointing a human gene that not only grows the mouse brain but also gives it the distinctive folds found in primate brains.

Agora outra equipe suplantou aquele feito, identificando um gene humano que não sómente faz crescer o cérebro do rato, mas tambem dá a ele as distintas camadas encontradas no cérebro dos primatas.

The work suggests that scientists are finally beginning to unravel some of the evolutionary steps that boosted the cognitive powers of our species.

O trabalho sugere que os cientistas estão finalmente começando a desvelar algums dos passos evolucionarios que deflagrou os poderes cognitivos da nossa espécie.

( tradução a continuar)

 “This study represents a major milestone in our understanding of the developmental emergence of human uniqueness,” says Victor Borrell Franco, a neurobiologist at the Institute of Neurosciences in Alicante, Spain, who was not involved with the work.

The new study began when Wieland Huttner, a developmental neurobiologist at the Max Planck Institute of Molecular Cell Biology and Genetics in Dresden, Germany, and his colleagues started closely examining aborted human fetal tissue and embryonic mice. “We specifically wanted to figure out which genes are active during the development of the cortex, the part of the brain that is greatly expanded in humans and other primates compared to rodents,” says Marta Florio, the Huttner graduate student who carried out the main part of the work.

That was harder than it sounded. Building a cortex requires several kinds of starting cells, or stem cells. The stem cells divide and sometimes specialize into other types of “intermediate” stem cells that in turn divide and form the neurons that make up brain tissue. To learn what genes are active in the two species, the team first had to develop a way to separate out the various types of cortical stem cells.

After months of work, the researchers finally hit upon a solution. They added distinctive fluorescent tags to stem cells so they could isolate each type of cortical cell. Then they surveyed the active genes in each variety of stem cell. The human tissue had 56 genes that their mouse counterparts lacked, the team found. The one that was the most active in dividing human fetal stem cells was ARHGAP11B, a gene already under suspicion for aiding human evolution.

Several years ago, another group had discovered that this gene had arisen after an ancestral gene made an incomplete copy of itself. Because humans had the additional version whereas chimps did not, they concluded that the duplication occurred after the human and chimp lineages split off. Neither mice nor chimps have ARHGAP11B, but modern humans and their ancient relatives, the Denisovans and Neandertals, do. “That it was a human-specific gene duplication made it very exciting,” Huttner says.

After their genetic comparison of human and mice highlighted the same gene, he and his colleagues decided to put ARHGAP11B into developing mice. The number of cortex stem cells nearly doubled in the animals, and their brains sometimes developed folds, the researchers report online today in Science. The folds are not seen in mice but are found in primates. The researchers further discovered that the inserted gene causes some of the mouse’s early brain stem cells to make more intermediate stem cells than the animals usually have. In addition, those intermediates divided more frequently than normal before beginning to convert into neurons. These various effects ultimately increased the size of the mouse brain.

The result “emphasizes the likelihood that this gene was indeed important during mammalian evolution for the design of a new brain, bigger and more complex,” Borrell Franco says. Most likely, he adds there are more genes that are also involved in this design waiting to be discovered. 

—–

E meu comentário publicado no artigo da Science AAAS.Org 

Avatar

Congratulations to those researchers, but they made a mistake about the interpretations of the phenomena. Saying that “this gene had arisen after an ancestral gene made an incomplete copy of itself ” produces the belief that it was an event by chance due an error, which is not the case accordingly to Matrix/DNA Theory’s models. Same event has occurred when the plant cells divided and had arisen the animal cells, when the gene for chloroplast did not worked well. So, it is a pattern in evolution’s process. The Matrix/DNA formula for natural systems explains how and why such events occurs. That gene of chimpanzees was performing a normal function leading the brain as a system to be a closed system, which is against the evolutionary force and triggers the action towards opened systems, and expression of related genes. The complete explanation can be seen in this article ” Porque Humanos Desenvolveram Cérebro Diferente dos Ancestrais? Por um Êrro Genético…!?”, in Portuguese.

 

O Sistema Volta a Atacar: 98% do DNA é mesmo Lixo, Portanto não foi inteligente desenhado por Deus. Mas a Matrix/DNA…

segunda-feira, maio 13th, 2013

( Atenção  continua o debate na seção de comentários do artigo na LiveScience onde estou participando com vários posts (copiados aqui no fim deste artigo) – apesar de que alem de eu estar expondo uma cosmovisão que ninguém conhece, o meu rude inglês espanta leitores)

Escritores sobre Ciências na Mídia estão parecendo ter uma agenda doutrinaria, e respeitadas revistas/jornais cometem absurdos como esse de hoje no conceituado LiveScience, onde o titulo de um documento cientifico foi totalmente mudado por outro titulo tendencioso.

O documento cientifico (paper) foi publicado no Journal Nature sob o titulo:

Architecture and evolution of a minute plant genome

http://www.nature.com/nature/journal/vaop/ncurrent/full/nature12132.html

Nature – doi:10.1038/nature12132 – Published online – 12 May 2013

Mas o grande publico não lê estes difíceis jornais especializados então quando um assunto interessa ao publico, escritores da disciplina os resumem e traduzem para um linguajar popular para que o publico entenda e o publica nestas revistas cientificas.

( Um parêntesis para um aviso: ai atras eu disse “publico” e logo a seguir “publica”. Quero esclarecer que “publica não é a fêmea do publico e nem as duas palavras se referem a mesma especie, pois enquanto “publico” é um substantivo, “publica” é a terceira pessoa de um verbo (ele publica). Acho que assim deve ser um repórter  respeitar o publico dizendo a verdade e tomando todas as providencias para que os leitores não interpretem errado). Neste ponto você me diz: “Louis, não enche o saco, ou você vai pentear macaco no zoológico ou escreve logo essa porra desse artigo!” – “Tá bom, chefe, tá bom, eu já vou…”

Pois o escritor/repórter pegou o documento cientifico, fez seu trabalho e publicou isso:

LiveScience

‘Junk’ DNA Mystery Solved: It’s Not Needed

http://www.livescience.com/31939-junk-dna-mystery-solved.html

Tia Ghose, LiveScience Staff Writer
Date: 12 May 2013 Time: 01:00 PM ET
Meu-I-don’t-nao-sei-if-existe-God !!! Uma coisa nada tem a ver com a outra! Para quem não esta informado, nos USA esta havendo uma guerra acirrada entre religiosos cristãos reunidos por trás da bandeira do “Intelligent Designer” e os ateus-materialistas reunidos por trás da “Biologia Evolucionaria”. São duas doutrinas opostas lutando pelo poder e pelo money, pois quem ganhar se assenta no curriculum escolar e assim forma a mente de seus futuros submissos e fieis fregueses. E o assunto do “DNA-Lixo” tem sido um dos locais principais no campo de batalha. Porque o DNA humano por exemplo tem lá apenas 2 a 3% daquelas letras de código  TCAG, alinhados em sequencias alternativas e logicas o que indica grupos de genes e todos estes genes foram identificados exercendo funções biológicas, enquanto os outro 97 ou 98% tem suas letras numa bagunça e estranheza explicita, formando longos trechos com uma só letra sendo repetida ao infinito, depois pula para trechos tresloucados onde curtas repetições se trombam com uma letra sem repetição para voltar a outra que se repete… e assim não se identifica genes e não se descobre se tem alguma função   Então a muitos anos atras alguém exclamou: “Isso é lixo!”. O colega do lado gostou do nome e saiu correndo para ser o primeiro a escrever ao mundo o nome “DNA-Lixo” (Junk-DNA em Inglês).
Foi a oportunidade que os materialistas esperavam! Se a maioria do DNA é lixo isso é prova que não teve nenhuma inteligencia desenhando, criando a vida, portanto… Deus não existe. “Calem a boca e caiam fora das escolas!” – disseram aos religiosos, os quais, é claro, não se deram por vencidos por que a sabedoria humana é nada, estão sempre enganados e perdendo perante a sabedoria divina, e botaram um exercito de cientistas religiosos em alerta nos laboratórios para esclarecer aquilo.
Mas apareceu o gigantesco Encode Project com a missão de mapear todas aquelas letras dando nomes a funções  etc., e de seus relatórios começaram a aparecer continuamente noticias de que descobriram funções para uns trechos do lixo aqui, mais outras importantes funções de outro trecho ali… e a imprensa no mundo todo estourou de artigos de escritores cientistas pro-Intelligent Designer: “Estão vendo… Eu sempre disse… não existe essa coisa de DNA-Lixo.”  E os pastores nas missas de domingo exigem:  –  “Que esses evolucionistas Darwinistas caiam fora das escolas…Deus seja louvado!”
 Mas como podem ver neste exemplo, parece que os materialistas continuam ferrenhos na luta. O titulo do nobre trabalho de verdadeiros humildes cientistas que gastam suas vidas de guarda-pó branco noites adentro tentando arrancar segredos daquelas letrinhas para curar grandes doenças elaboram um titulo curto, pratico, que vai direto ao assunto e explica a realidade do trabalho ( Arquitetura e Evolução do Genoma de uma Pequena Planta), mas o escritor pegou o documento, foi para casa, telefonou para aqui, pra ali, pensou, pensou, e escreveu seu titulo: ” O Mistério do DNA-Lixo Está Solucionado: Ele não é Necessário”.
Porque não estou na selva agora e meus amigos macacos não estão aqui, não posso dizer “macacos me mordam”, então fico me mordendo a mim mesmo de indignação  Pois da minha leitura do documento cientifico, não captei nada provando que aquele trecho dos 97% tenha sido inteligentemente desenhado, e muito menos que a redução do tamanho daquele trecho na planta estudada indique que ele pode ser dispensado que em nada alteraria a vida dos vivos (claro, não poderia ser a vida dos mortos, baaahhh…). E muito menos ainda diz alguma coisa sobre o grande mistério ter sido solucionado.
Mas como não tenho tempo agora para fazer a demorada analise necessária e traduzir aqui, vou saltar para o verdadeiro objetivo deste artigo: vender meu peixe. Como sempre só vendo uma especie de peixe, chamada “Matrix/DNA”.  Mas esta não é uma doutrina porque eu não acredito nela e sou o único a conhece-la. Porem ela sugere uma terceira alternativa, o que seria muito bom para acabar com essa guerra e mandar os dois grupos de teimosos para casa. E deixar a mente dos estudantes livres sem doutrinas, apenas com teorias a serem testadas.
Tenho já vários artigos que podem ser reunidos puxando-se aqui a categoria “Junk DNA”. E colhendo informações destes scientific-papers vou juntando as peças do quebra cabeças guiado pelas luzes da formula da Matrix/DNA. O junk é lixo ou o lixo não é lixo…
Para resumir quase nada explicando para os leigos nessa visão de mundo, as origens do DNA remontam a 13,7 bilhões de anos atras, na forma das ondas de luz branca positivas que foram emanadas no Big Bang e que se fragmentavam em pedacinhos de luz  chamados fótons  Estes fótons adentravam as partículas de uma massa etérea que era luz escura congelada que muitos nomes tem recebido, tais como Higgs field, matéria e energia escura, etc.  E estes fótons era a energia que fazia as partículas de massa inertes a se moverem porque os fótons queriam material para reproduzir o sistema saudoso que existia antes do Big Bang e que fora a fonte daquelas ondas de energia  do Big Bang. Enfim os fótons faziam o mesmo papel que os genes masculinos fazem depois que explode o involucro do espermatozoide e se juntam aos genes femininos e começam a trabalhar para reproduzir o sistema de onde vieram, que os espera de bracos abertos e ansiosos alem do seu pequenino universo intra-uterino.
Fizeram sistemas atômicos  sistemas estelares, sistemas galácticos .. ou seja, um sistema universal ia mudando de formas assim como qualquer corpo humano quando esta nas suas origens apresenta as formas de morula, blástula  feto, etc… Mas assim como o feto continua mantendo em si os genes que trabalharam na época da construção das bases do edifício  nas formas da morula, blástula  talvez nada mais tenham a fazer e foram aposentados, porem a criança não os expulsou de seu DNA, assim também os fótons juntos com os bosons de Higgs que trabalharam fazendo a massa de átomos para o reboque na base do edifício  depois os que trabalharam construindo a forma astronômica  talvez nada mais tenham a fazer e estejam aposentados, mas a forma biológica  com suas plantas e animais, não os expulsaram da Matrix/DNA universal. E não teriam como expulsar! O DNA dos biológicos veio de seus pais, a Matrix/DNA veio dos pais da Luz! Estão certos os animais e as plantas, não poderiam cuspi no prato em que comeram, e o amor pelos pais é o ultimo que morre. Assim como o meu pai e minha mãe que fizeram o meu bigbang aqui na Terra, amo tanto os meus quaqui-tataravós que fizeram o meu mais antigo bigbang la no seu universo. Deixem os fosseis e os ainda vivos ancestrais sossegados no nosso DNA e respeitem-nos, pois lixo é o cocuruto desses caras que inventaram esse nome.
Agora eu me pergunto: O que aconteceria ao corpo de uma criança se de repente se apagasse todo seu passado, de maneira que nenhum traco do mundo que existiu entre o momento do bigbang de seu espermatozoide ate o momento que seu corpo se tornou criança  seria tudo enterrado numa amnesia total… Não faço a minima ideia. Sera que mudaria alguma coisa no corpo da criança ou não mudaria nada e mesmo ela no seu futuro desenvolvimento nunca mais precisaria daquelas informações do seu passado… ( não reparem nas minhas perguntas sem ponto de interrogação  não é culpa minha, acontece que a Marylin, a minha baratinha de estimação que vive aqui na minha mesa e é minha sócia no meu cafe e nos meus biscoitos, não sei porque sumiu com meu ponto de interrogação  como já tinha sumido com meus acentos desse teclado que só sabe falar inglês).
O trecho antigo do DNA apresenta aquelas longas repetições da mesma base nitrogenada por dois motivos: a) nos inícios tanto do sistema universal quanto dos nossos corpos, as formas eram simplicíssimas  eram apenas as bases, os alicerces, onde iam quase puro cimento. As células humanas na fase da morula e blástula ainda quase nada se diferenciaram, parecem todas o mesmo tipo de tijolinhos. Ferro, madeira, canos, fios, etc., começam a vir depois na construção de um edifício  assim também as nebulosas de átomo eram compostas apenas por um tijolinho, o átomo  e não tinham forma definida, era uma massa. Repetições de uma unica letra é o mesmo que repetição de tijolinhos levantando paredes, fazendo grandes nebulosas de átomos leves gasosos simples. E aquela repetição parece interminável  indo quase ao infinito… é porque assim acontecem as coisas no tempo astronômico  A construção de nebulosas ate galaxias demorou 10 bilhões de anos. Isso foi Historia, composta de eventos, passos do simples para o complexo, a Matrix/DNA registra essa Historia tim-tim por tim-tim.
Para que e como ficariam ativos os genes que construíram rabos nos nossos antepassados… Aqueles que estão reclamando, cuidado, pois o pai la em cima pode ouvir, atender seu pedido, reativar estes genes hoje a noite, e amanha vocês amanhecem arrastando um belo rabo atras…
Eu acho que muitos daqueles genes continuam ativos, porque, principalmente, nossos corpos tem esqueletos, que são os representantes biológicos da mecânica newtoniana relativa a mecânica celeste, que muitas vezes estes ossos quebram, perdem pedaços  e quem no corpo tem que voltar correndo das ferias e por as mãos .. senão os genes do passado… So eles sabem e tem porte físico forte para aguentar e fazer a massa… essa juventude de genes de hoje, coitados, é tudo cocotinhas.
Bem, antes de terminar e sem fazer uma explicação do documento cientifico segundo minha cosmovisão  só vou avisar mais uma coisa. Na experiencia os pesquisadores descobriram que houve três eventos de duplicação dos trechos ativos do DNA naquela planta carnívora  Como o DNA não aumentou de tamanho se aumentou a quantidade de genes… Boa pergunta. A explicação que encontraram foi a de que a cada evento o DNA cortava um pedaço do seu “lixo” e o dispensava. Por isso os materialistas comemoram com tremoços e tequila numa algazarra estrondosa para o mundo inteiro escutar. Se o lixo foi dispensado e a planta continua muito bem obrigada, de saúde  é porque o lixo não é mais necessário  Certo… A Matrix/DNA esta dizendo que essa interpretação esta errada porque se esquecem que genes são grandes pacotes de informação como atomos são pacotes de particulas mas mesmo assim tem a maioria do seu espaço interno vazio, no qual pode ser absorvido um montão de outras informações e ficarem armazenadas la no porão  em nada sera alterado. Esse pessoal não conhece nada de computação .. não sabem que arquivos são com-preensados para serem aguardados sem ocuparem maiores espaços ..  Estou avisando… os aposentados estão ainda por ai…
O artigo na revista diz que pode-se cortar fora o lixo que em nada afetara o corpo. Sei não .. E o mesmo que dizer que pode-se eliminar todas as especies que na sua época trabalharam e cumpriram sua missão nas sendas da evolução  e mesmo depois da missão cumprida continuam existindo, como as bactérias  os cavalos, os cachorros, as vacas…So um louco poderia sugerir que eliminemos os pássaros porque ja saíram fora do tronco da arvore da evolução e nada mais tem a fazer neste mundo… pois como nos poderíamos ter tido hoje neste lindo domingo que é também o dia das mães  a imensa felicidade de ter visto o amplo sorriso nas faces de nossas mães quando lhes entregamos aquele lindo bouquet de flores, se não houvessem os pássaros para polinizarem as flores… Sim, eliminem os pássaros  as bactérias  as vacas e os cavalos , como disseram que as carnívoras cortaram e jogaram fora o lixo, e esperem para ver como seus corpos sobrevivem sem alterações  Os meus pais puseram tanta inteligencia no ato de me fazerem quanto a girafa pôs quando fez a girafinha. Esta certo, não estou vendo a necessidade de uma grande inteligencia atuando nisso tudo ai. Que o outro time não pense que a Matrix/DNA esteja torcendo por eles. O jogo continua empatado.  
Mas não acreditem em nada do que falei porque eu mesmo não acredito. Eu não acredito nas teorias, e muito menos seria um louco irresponsável se tentasse impo-las como doutrina goela adentro de inocentes estudantes. Teorias estão ai para sugerirem novos experimentos para testa-las e nos fazer alertas para perceber-mos sinais do mundo que sem elas, eles podem continuar passando debaixo dos nossos narizes e nos não os vemos. Como as enfermeiras não estão vendendo nas maternidades que aqueles lindos bebes chorões estão ali porque seus pais são tao desastrados como os pais dos bebes que nascem de grandes ovos universais: só sabem fazer bebes através de escandalosos bigbangs…

Meus Comentarios Postados em LiveScience:

Louis Charles Morelli · Queens

Title in Nature is ” Architecture and evolution of a minute plant genome” and the scientis’ phrase that inspired Ghose`s title “the compressed U. gibba genome after three WGD`s indicates that there were supression of junk and not alteration of the plant”. Logical and comprehensible interpretation from materialist paradigm viewpoint. But from the Matrix/DNA Theory viewpoint the scientific results does not leads to Ghose’s interpretation. Compressed files are identical to original when “zipped”. The informations stored at junk must be still there. But how? DNA is a pile of systems called nucleotide and every system has 95% internal space empty (like atoms, galaxies). So , instead removing non-expressed but indispensable informations for accommodating three new copies of 3%, more internal space is used. Long repetitions of letters means that slow events at cosmological time is registered without suppressing the fast events occurring at microscopic time. It is general relativity plus quantum mechanics applied by the universal Matrix.
– – – – – – – –

Louis Charles Morelli · Queens

This is a very important issue that affect all of us, it is about the root of diseases that are killing and torturing human beings. Another scientific paper today says ” New Layer of Genetic Information Discovered” (you can google it). As it is falling the old paradigm about codon redundancy, this one about junk DNA will falls also. As I said at my posts below, it is a weird and never imagined before situation, but it is logical and rational: like all species in biological evolution contains a natural organizing formula (DNA) – all systems of cosmological evolution contained differents shapes of the same formula of DNA, which we call “Universal Matrix/DNA”. And lot of things makes sense when we calculates how cosmological evolution should be encrypted into a code…and then, we have the junk DNA. There must be hidden the causes of many diseases… we need changing the current paradigm.
– – – – – – – – –

Kenneth Musson · Follow ·  Top Commenter · NOW RETIRED at None yet

I am of the opinion that ‘junk’ DNA, when decoded, will reveal the entire library of human existence, explaining our origins, purpose and knowledge, known and unknown. I would not be surprised if science isn’t already aware of this, and keeping such away from the rest of us. Considering that we humans use about ten percent of our brains, can only see ten percent of the light spectrum, and apparently only ten percent of our DNA is ‘useful….’

Louis Charles Morelli · Queens

Kenneth, you have a good point, which leads me to a new insight. DNA is the written History of Biological Evolution plus Cosmological Evolution. The whole Universal History is product of advancing the light wave emitted at the Big Bang, 13,7 billion years ago. Biological evolution happens at the infrared and visible frequency, and a little bit of microwave frequency, which are the frequencies that we are reaching with our natural and scientific sensors. So, my suggestion is that we apply light at ultraviolet,X-ray,and gamma-ray frequencies over junk DNA. I don’t know if it is possible doing it, but, the past times of cosmic radiation must reveal the past time of History, encrypted at DNA, just at the region called “junk”. That’s suggestion from Matrix/DNA models and maybe it is wrong. I would put my two cents in this experiment.
Reply · Like · 2 seconds ag
– – – – – – – – – –

Louis Charles Morelli · Queens

Walter, the offspring sample of yours hypothetical experiment never will be reproductive. What will happen if an adult father takes out from his DNA the informations about his earlier shapes, as blastulae, fetus, children and pass on this DNA for reproduction? The son will born with same shape of the father? Or will have not a birth? Some letters of junk must be indispensable for building the first shapes as morula and blastula and even the entire skeleton. Yours experimental sample will suffers lapse of continuity by the same motive that Urey experiment never got the next evolutionary step from his amino acids.Ok, I am expressing the opinion of Matrix/DNA Theory and could be wrong
Louis Charles Morelli · Queens

Louis Charles Morelli · Queens

I think yours post means: ” We need better tech to see into the darkness of “junk” DNA. The revolution will be the same when Galileo pointed out a new tech to the darkness of sky and now when better tech discovered those planets. Am I right?
rikmun (signed in using yahoo)

OK. I often find no use for the parts leftover after I reassemble some device. Just throw them out. Why keep them?
Louis Charles Morelli · Queens

But… the junk DNA does not contain leftover parts, it contains the tools for making the device. What if yours device need repair or the environment changes and yours devices need be mutated for adaptation? The Matrix/DNA Theory suggests that “if” those crystals existing at pineal gland is not found in Nature, the junk will be expressed for doing it. Why? The junk is register of cosmological evolution, from Big Bang till the moment that arose biological systems. Those 3% active genes are about biological evolution. But… crystals were made by stars, so, if they are missing, the agents for doing them are sleeping in the junk and will be awake up. Nature never destroys its own mechanisms, even that in such epoch and environment they are not being used. I suppose that they still are compressed inside U. gibba genome.
XXXX
Analise comentada/traduzida do documento cientifico:
It has been argued that the evolution of plant genome size is principally unidirectional and increasing owing to the varied action of whole-genome duplications (WGDs) and mobile element proliferation1. However, extreme genome size reductions have been reported in the angiosperm family tree. Here we report the sequence of the 82-megabase genome of the carnivorous bladderwort plant Utricularia gibba. Despite its tiny size, the U. gibba genome accommodates a typical number of genes for a plant, with the main difference from other plant genomes arising from a drastic reduction in non-genic DNA. Unexpectedly, we identified at least three rounds of WGD in U. gibba since common ancestry with tomato (Solanum) and grape (Vitis). The compressed architecture of the U. gibba genome indicates that a small fraction of intergenic DNA, with few or no active retrotransposons, is sufficient to regulate and integrate all the processes required for the development and reproduction of a complex organism.
      Breve traducao:
Tem-se acreditado que a evolucao do tamanho do genoma de plantas ev principalmente unidirecional e  crescente devido a variada acao das duplicacoes do genoma inteiro (DGI em portugues), e movel proliferacao dos elementos. Todavia, reducoes extremas no tamamho do genoma tem sido observadas nas plantas da familia angiosperma. Aqui nos reportamos  a sequencia do genoma 82-megabase da planta carnivora Utricularia gibba. Apesar de seu diminuto tamanho, o genoma da U.G. acomoda o tipico numero de genes das plantas, com a principal diferenca das outras plantas emergindo do fato de que ocorre drastica reducao nos nao-genicos do DNA. Inesperadamente, nos identificamos ao menos tres rodadas de DGI (duplicacoes do genoma inteiro) na U.Gibba desde seu comum ancestral entre o tomate e a uva. A compreensada arquitetura do genoma da U.Gibba indica que uma peguena fracao do DNA inter-genico, com poucosou nao ativos retrotrnsposons, ev suficiente para regular e integrar todos os processos requeridos para o desenvolvimento e reproducao de um complexo organismo.
Meu Comentário: O escritor da LiveScience destacou a ultima frase acima para tirar sua conclusão,  a qual, do ponto de vista do paradigma da Biologia Evolucionaria, é perfeitamente logica e compreensível  Mas do ponto de vista da Teoria da Matrix/DNA o texto todo acima não autoriza essa conclusão  O principal fator do conflito esta na palavra “compressed”. Vou ate recorrer ao dicionario de Inglês para ver se seu significado é o mesmo que em Português…

Definition of COMPRESS

transitive verb
1
: to press or squeeze together
2
: to reduce in size, quantity, or volume as if by squeezing<compress a computer file>
Ok. Quando a gente ^compressa ou comprime um arquivo, seja de computador ou do DNA, a gente esta dispensando as informações menos importantes e as retirando do arquivo ou a gente esta diminuindo o tamanho de letras, espaços em branco, etc…. Esta é uma pergunta sem o ponto de interrogação que sumiu do teclado. Não entendo assim de computação mas acho que compressar um arquivo não o altera, não é o mesmo que resumir o arquivo. Mas eu nunca acredito nas minhas conclusões, por isso vou insistir em estudar isso.
HowStuffWorks.Com

How File Compression Works

If you download many programs and files off the Internet, you’ve probably encountered ZIP files before. This compression system is a very handy invention, especially for Web users, because it lets you reduce the overall number of bits and bytes in a file so it can be transmitted faster over slower Internet connections, or take up less space on a disk. Once you download the file, your computer uses a program such as WinZip or Stuffit to expand the file back to its original size. If everything works correctly, the expanded file is identical to the original file before it was compressed. 
Ahhhh…. Ganhei! Enquanto os cientistas se limitaram a dizer que o DNA foi compreensado, o escritor da LIveScience disse:
” The difference was in the junk: The bladderwort plant seemed to have stripped out a vast amount of noncoding DNA. Yet the plant did just fine without that material.”
Traducao: ” A diferença estava no lixo: A planta parece ter removido ( em Quimica, significa remover um componente quimico de uma mistura) uma vasta quantidade de nao-codificadores do DNA. Ainda assim a planta se saiu muito bem sem aquele material.”
E agora… o que voces me dizem…
A parte invisivel do DNA lixo foi jogada fora ou foi prensada e enfiada nos poroes do DNA mas continuam la…
Veja bem. Um trecho que apresenta mil repeticoes da letra C, significa – pela otica da Matrix/DNA – que um periodo de tempo na epoca  que formavam estrelas e galaxias, a sedimentacao de atomos pesados (ferro, manganes, etc.) que haviam sido feitos pelas primeiras estrelas demorou mais que a anterior sedimentacao de atomos leves gasosos (helio, hidrogenio, etc.) quando se formava as primeiras estrelas. Isso acontece conosco aqui: fazemos muito mais rapido um monte de algodao que ev mais leve do que o mesmo monte de pedras. Mas naquela epoca nao era o DNA biologico a formula universal que servia de forma para se assentar a materia e formar arquiteturas, era a Matrix Universal, ou seja a formula do DNA do Universo. Seja a Matrix ou seja o DNA todos os eventos dentro de um mesmo intervalo de tempo tem que serem registrados na memoria por igual. Nao ev por que os homens vivem 80 anos e as particulas apenas 17 milionesimos de segundos que vou registrar todos os eventos em 10.000 anos de historia das particulas e vou reduzir, apagar, eventos da historia dos humanos para que as duas historias caibam no mesmo tamanho de uma fita de gravacao. Um humano demora meia hora para jantar, uma particula engole um foton que ev seu jantar em bilionesimos de milionesimos de segundo. Entao na minha fita de memoria vou ter que registrar o levar do garfo a boca do humano com apenas um C
 enquanto a engolida da particula vai uma repeticao de mil C’s. Assim registrei meia hora, tanto para uma historia como para a outra e fui fiel a historia do ponto de vista de um terceiro observador, no caso, a Matrix do Universo. Ela, quando se tornou DNA biologica veio de sua forma como galaxias e tinha que trazer consigo toda sua historia real e nao apagar o passado quando foi nebuilosa de atomos, sistemas estelatrs. Se meu pai tivesse apagado as informacoes no seu DNA referentes a suas formas de morula, blastula, crianca, adolescente, e so transferido as informacoes da sua forma adulta quando me concebeu, como ev que eu iria nascr na forma de bebe chorao… Eu teria nascido com quase dois metros e 90 quilos! Mas isso que esse escritor esta acreditando e informando…
Genes sao pacotes de informacoes.     Ou seja, sao grandes quantidades de bits-informacao. Estas informacoes formam sistemas, que sao os pares horizontais de nucleotideos. E sistemas sao praticamente ocos por dentro, como sao atomos e o Sistema Solar. Se eu quiser manter o tamanho da Milk Way depois que ela foi invadida por mais estrelas e planetas que vieram de fora, eu nao preciso cortar e jogar fora os sistemas estelares que estao aqui. Para que… Se 98% domeu espaco interno esta vazio. Basta acomodar on novos intrusos no espaco. Foi isso que aconteceu no DNA cada vez que houve duplicacao dos 2% de genes ativos e estas tres copias foram incorporadas dentro do mesmo DNA. A Natureza de maneira alguma joga fora seus mecanismos, processos, que ja foram aplicados, expressados antes, pois a qualquer momento pode haver uma nova necessidade de uma especie devido uma mudanca ambiental e os antigos podem fornecer o recurso certo para essa necessidade devem continuar encriptados no DNA, prontos para serem reativados. Pois o que chamam de trechos de lixo sao trechos de codigos de genes que sao capazes de executarem  mecanismos.
Estou certo ou errado… Ou melhor, a Matrix/DNA, esta certa ou errada… So o tempo pode ser o juiz, mas acho que ele vai me dar ganho de causa.
E pensando nisso, vou dar uma pausa aqui e tentar elaborar um post em ingles e tentar posta-lo no debate que se seguiu ao artigo na LiveScience.

(Parei Aqui)

Title in Nature is ” Architecture and evolution of a minute plant genome” and the scientis’ phrase that inspired   Ghose`s title “the compressed U. gibba genome after three WGD`s indicates that there were supression of junk and not alteration of the plant”. Logical and comprehensible interpretation from materialist paradigm viewpoint. But from the Matrix/DNA Theory viewpoint the scientific results does not leads to Ghose’s interpretation. Compressed files are identical to original when “zipped”. The informations stored at junk must be still there. But how? DNA is a pile of systems called nucleotide and every system has 95% internal space empty (like atoms, galaxies). So , instead removing non-expressed but indispensable informations for accommodating three new copies of 3%, more internal space is used. Long repetitions of letters means that slow events at cosmological time is registered without suppressing the fast events occurring at microscopic time. It is general relativity plus quantum mechanics applied by the universal Matrix.

 

 

 

Organismo Sobreviveu 80 Milhões de Anos Sem Sexo! E Adquiriu Novos Genes! São Evidencias para Matrix/DNA Theory!

sábado, novembro 17th, 2012

ScienceDaily (Nov. 15, 2012)

http://www.sciencedaily.com/releases/2012/11/121115172032.htm

Tenth of Quirky Creature’s Active Genes Are Foreign: Believed to ‘Ingest’ DNA from Other Simple Organisms

Êste organismo é asexual devido não ter machos, apenas fêmeas e mesmo assim, se reproduzem. Duas estrannhas novidades dêste organismo: 1) 10% de seus genes não são genes presentes em nenhum outro organismo, mas são encontrados numa espécie inferior de vida –  micróbios. E êstes genes estão ativos, foram incorporados ao material genético do organismo; 2) O organismo vive em umidos, aquíferos habitats, porem, quando ocorre uma prolongada sêca o organismo tem habilidade para evitar seu ressequimento ( uma espécie de urso-hibernação ao contrário) e voltar à vida quando o liquido retorna.

Tudo isto clama pela fórmula da Matrix/DNA. É inevitável! Basta observar a figura da Matrix quando estava na forma de LUCA para ver as fontes, as fôrças e elementos que lá estão disponiveis para se fazer o que este organismo faz. Falta de tempo agora, retornarei a êste artigo dando uma explicação mais detalhada. Por enquanto, quem quiser exercitar sua habilidade para entender a Matrix, observe que o aspecto “fêmea” do organismo já o coloca no lugar da Função 1 da fórmula. E a incorporação de genes do ambiente é explicada pelo processo pelo qual LUCA se transfere para a superficie da Terra.

Porque e Para que Existem Formas de Vida Separadas no Universo e Como será nossa Conexão

quinta-feira, setembro 22nd, 2011

Para entender isso é preciso fazer uma analogia com o DNA. Afinal de contas, o código da vida na Terra veio e surgiu no Universo, então porque não seria nossa versão da vida no inteiro Universo? O DNA apresenta quase 98% de áreas que parecem não terem serventia. São imensas regiões de bases repetidas ou aleatórias, como AAAAAAAAAAGTCCCCCCCAAAAAA… Chamam essas áreas de DNA-Lixo. Agora pensem no Cosmos, as vastas regiões de estrêlas e galaxias como se espalhadas aleatóriamente. São estas vastas regiões estruturais repetitivas que representa o DNA-Lixo.

No meio destas regiões do DNA existem como que ilhas, de grupos de genes ativos. Num processo de reprodução, quando os genes constróem um novo corpo humano, em cada ilha, cada grupo tem a função de construir um órgão. Uns vão fazer o fígado, outros o coração, outros o cérebro, outros os olhos, o nariz, etc. Enquanto estão no começo, os genes de uma ilha não tem porque se comunicarem com outras ilhas. Quando o novo ser começa a tomar forma, saindo da fase de blastula, formando os inicios do feto, tem inicio alguma aproximação, algum cruzamento, entre genes de diferentes ilhas, pois tambem começam-se a definir os canais, estruturas que vão ligar os órgãos entre si.

Mas todo este enredo não acontece apenas com nosso DNA em nossa reprodução. Todo esse quadro e enredo é agora ampliado ao tamanho do Universo. Existem seres na galaxia Via Láctea, mais exatamente no planeta Terra e eles são genes construindo um órgão de um futuro corpo. Ao mesmo tempo, em várias outras galaxias existem grupos de seres construindo outros órgãos, mas todos para um mesmo futuro corpo.

Que corpo é êsse, qual será sua forma, sua substância?

Os corpos dos bebes humanos são da mesma substancia dos corpos dos genes. Digamos… matéria biológica. Mas quem está construindo o bebê cósmico não são os humanos na Terra, nem os orionenses em Orion, etc.. Quem o está constriuindo é a consciência que existe nos corpos destas criaturas. Assim como os genes biológicos não têm a menor idéia de que estão fazendo um corpo humano, assim tambem estas consciências não percebem ainda o que estão fazendo, porque existem. Mas por serem genes-consciência, logo que os órgãos começam a tomar forma começam a perceber o significado de sua existência, como estamos percebendo agora. Os órgãos dêsse bebê mental, mal saindo agora da forma da blastula, estão tomando forma, mas se constituem, por enquanto, no consciente coletivo de cada grupo de seres. Aqui na Terra por exemplo a forma atual é como um anel meio esvoaçado, a camada do consciente coletivo que circunda o planeta rente ao solo.

É um corpo mental, holográfico se assim prefere, da mesma substancia da nossa mente. Sua definição será algo como “A Consciência do Universo de Sua Própria Existência”. Mas êsse corpo mental não será algo disforme como uma nuvem, nem algo como uma esfera chamejante. Ele terá uma forma funcional, a forma de um sistema, tal como nosso corpo carnal tem a forma e funciona como um sistema. Observe o sistema desenhado na forma de diagrama/software da Matrix/DNA. Essa forma serviu como template, lay-out, para todos os sistemas naturais materiais, mas assim como os sistemas naturais evoluíram, desde átomos a corpos humanos, assim tambem a fórmula da Matrix está sob evolução, ainda. Esta é uma forma evolucionaria provisória. Não sabemos como será a forma final da Matrix, por isso não podemos saber da forma final do corpo mental.

É preciso lembrar ainda algo de suprema importancia. Sabemos que quem estava no meio daquela sôpa amôrfa que era a mórula no inicio do nosso corpo, eram os genes. Os quais compunham o que denominamos “genoma”. Mas o genoma surgiu ou têve origem na mórula? Dentro do saco embrionario? Não, ele existia a muito tempo antes de iniciar a formação do saco embrionario. Veio de nossos pais? Não, ele já exisxtia antes deles. De nossos avós? Não, pois pelo que se sabe na Terra as moléculas de RNA/DNA começaram a bilhões de anos. E se a fórmula da Matrix/DNA estiver correta, eles foram montados biologicamente aqui vindo na forma de fotons que compunham o DNA da galaxia. Surgiram então na galaxia? A fórmula já os detectou antes, como vórtices quanticos pipocando no momento do Big Bang, da fecundação universal. Assim como o genoma em nosso corpo hoje não teve origem dentro do nosso pequeno universo embrionario que era o saco amniótico, ele tambem não teve origem neste Universo.

Porem, quando terminam de fazer um corpo, para onde vão os genes que o construiram? Morrem? Desaparecem? Sabemos que todos os dias tem células nossas morrendo e sendo substituídas por novas. Então todo dia morre um individual DNA e é substituido por nova cópia dêle mesmo. O DNA individual que morreu, acabou-se o mundo para êle? Então os genes dêle existiram como meros escravos uteis, usados para fazer um corpo e depois descartados?

Com nosso cérebro é diferente. Ali tem um amontoado de células que são feitas nos primeiros dias do corpo e se mantem vivas durante toda a vida do corpo. Então todos os genes que participaram da construção do corpo, quando este está pronto se encontram no cérebro, como mente diretora do corpo. Todos tornam-se num só, individuo. Aquêles que morreram nas demais células não foram os iniciais que participaram na construção do corpo final, assim como os demais animais na Terra que não possuem consciência não participam da construção do corpo mental.

Assim será com todas as formas de consciencias espalhadas no Universo hoje: todas reunidas num só corpo, um só bebê, um só ser que um dia não acreditará se lhe disserem que no principio êle era separado em bilhões de cópias dêle mesmo, como você agora tambem não admite isso. Um ser que nascerá no dia do Big Birth, para um mundo externo alem deste Universo. Onde provavelmente tenha alguem nos esperando com ansiedade e braços abertos para nos abraçar. Quer dizer,… para me abraçar, ou melhor,… para te abraçar… mas te abraçando estará me abraçando porque seremos um só… (raios, está dificil resolver isto…)

Portanto, não temam as outras formas de consciência que vanos começar a contactar em breve. Tem gente que está com mêdo: “Será que, se forem mais poderosos que nós,vão nos eliminar, ou escravisar?”

Os tempos de evolução dos órgãos de um novo corpo são iguais em todos os lugares, claro. Quando começar os contactos, siginificará que os órgãos estão em adiantado estado de construção, já se começam a formarem os canais de conexão, e assim como nós já teremos consciência da nossa missão e da missão dêles, eles certamente tambem já terão captado quem somos e qual nossa missão. Nenhuma raça-animal sem consciência, nem alguma hipotética inteligencia perversa de órgãos que estariam atrasados, virá aqui, nem poderia ser mais poderosa que nós, pois estamos dentro do tempo avançado da evolução em que já começamos a perceber o significado da existência. Todos os conscientes sabemos que temos de formar uma equipe de trabalho em conjunto. Afinal, nem nós, nem eles, seriam tão estupidos para eliminar ou sequer atrapalhar o trabalho de quem vai fazer nosso próprio nariz. Ninguem quer nascer aleijado. Por isso, os que fazem o cérebro sabem que não são mais importantes que os que fazem o dedão do pé.

Estou ansioso para iniciar logo êstes contactos, mas esta ansiedade não é lógica. Eu sou já uma consciência, o que significa que não sou um simples gene, mas o genoma. E para o genoma o tempo não é o tempo humano, êle se conta em anos-luz, que são muitos dos nossos anos. Não sei ainda quanto falta para os ógãos serem aproximados, não sei ainda quantas vêzes vou mudar os turnos entre a feitura da massa e cimento aqui embaixo e a subida com êsse material para por no tôpo do edificio, mas o que importa é que a obra não vai parar, o que significa que os contactos acontecerão no seu devido tempo.

Genoma Projeto, Craig Venter, Causas das Doenças e as Sugestões da Matriz/DNA

segunda-feira, novembro 22nd, 2010

http://www.spiegel.de/international/world/0,1518,709174,00.html

Der Spiegel

No site acima o magazine Der Spiegerl entrevista Craig Venter sôbre os dez anos que ele investiu sequenciando o genoma humano, onde Venter explica que temos aprendido muito pouco e o montante de dados obtidos não explicam quase nada. A Teoria da Matriz/DNA insiste que a chave do segrêdo para começar a entender tudo o qie precisamos está na fórmula da Matriz. Não só porque ela revela as origens e a história do genoma mas principalmente porque o genoma é composto de unidades –m os genes – que se juntam para formar sistemas e sub-sistemas, só então expressam funções e portanto tem que haver uma visão holistica sistêmica para entende-los, o qual é justamente o que nos fornece a formula sistêmica da Matriz.

Interview conducted by Rafaela von Bredow and Johann Grolle

 

Vejamos alguns iniciais e breves comentários da Matriz sôbre trechos desta entrevista:

1) SPIEGEL: How much would you be able to learn about us by doing so?

Venter: If anything, we don’t really know how to read the genome and it can’t tell us very much right now.

Matrix/DNA: O conhecimento da formula da Matriz é o que está faltando aos pesquisadores de campo para começarem a entender os genes.

2) SPIEGEL: The decoding of your personal genome has so far revealed little more than the fact that your ear wax tends to be moist.

Venter: That’s what you say. And what else have I learned from my genome? Very little. We couldn’t even be certain from my genome what my eye color was. Isn’t that sad? Everyone was looking for miracle ‘yes/no’ answers in the genome. “Yes, you’ll have cancer.” Or “No, you won’t have cancer.” But that’s just not the way it is.

Matrix/DNA: Chegou-se à conclusão que o cancer é causado por uma variação genética. Se não sabemos o que causa a variação e o que significa a variação, ficamos sem poder de ação. A formula da Matriz é capaz de identificar os genes a nível de átomos. A posição e o tipo de um átomo pode identificar a sua função na formula. Tendo todos os átomos identificados pode-se montar o gene segundo a formula de sistema. E tendo esta montagem pode se compara-la com a formula de sistems perfeito da Matriz e identificar onde está om defeito, porque o defeito ocorreu. Bem isto é o que penso, sem ter visto a coisa real no laboratório. Mas pode haver muitas outras possibilidades tendo-se conhecimento da formula.

3) SPIEGEL: So the Human Genome Project has had very little medical benefits so far?

Venter: Close to zero to put it precisely.

Matrix/DNA: Importante anotar isto.

4) SPIEGEL: Did it at least provide us with some new knowledge?

Venter: It certainly has. Eleven years ago, we didn’t even know how many genes humans have. Many estimated that number at 100,000, and some went as high as 300,000. We made a lot of enemies when we claimed that there appeared to be considerably fewer — probably closer to the neighborhood of 40,000! And then we found out that there are only half as many. I was just in Stockholm for the 200th anniversary of the Karolinska Institute. The first presentation was about the many achievements the decoding of the genome has brought. Then I spoke and said that this century will be remembered for how little, and not how much, happened in this field.

Matrix/DNA: Portanto são cerca de 20.000 genes responsáveis por milhões de funções, como as caracteristicas físicas. e produções, como as proteinas. É preciso ver o DNA como uma network constituída de individuos, onde os individuos são sistemas. Eles se juntam em diferentes grupos para produzirem algo ou se desviam em grupos causando doenças. Imagine a grande sociedade humana, como um unico individuo que è em si mesmo um sistema, se junta a um grupo de bairro, depois a um grupo nacional, variando para grupos de religião, ideologia, tipos de hobby, esportes, preferencias de alimentos, roupas, etc. Alem disso tem a variação localizada no tempo, por exemplo, os grupos ora compõem um sistema feudal, ora um sistema capitalista ou marxista. Essa variação no tempo dentro do DNA é demarcada pela posição do gene e do grupo na escala cronológica da fita de registros. Sem identificar cada individio como sistema seria como tentar entender a população e as produções de New York sem saber que certa pessoa é americana, outra chineza, outra cristã, outra é gorda, ou branca, etc. Mas o desafio para o conhecimento é sempre o mesmo e nós temos avançado nos conhecimentos. A principio um dado quadro natural parece muito complexo e insolivel mas com persistencia e método acabamos identificando chavers, denominadores comuns,significados, o que nos levaa então a de imediato compreender o todo. Imagine um nativo da Amazônia da primeira vez que vê um automovel. Parece simples por fora, como parecia fácil para os cientistas entender o DNA e detectar as causas das doenças. Mas quando abre o capô e se depara com aquela cena da parafernália de fios e peças, o nativo pode pensar que jamais irá entender aquilo tudo. Porem nós que já temos experiencia de muitos anos com automoveis temos um completo entendimento da coisa toda. Assim será na nossa busca de entendimento destas networks complexas como a dos genes, dos neuronios no cérebro, etc.

 5) SPIEGEL: There are hundreds of hereditary diseases that can be traced to defects in individual genes. You can determine a lot more than just probabilities through them. But that still hasn’t led to a flood of new treatments.

Venter: There were false expectations. Take Ataxia telangiectasia, for example, a horrible disease. The nervous system degenerates, and people who have it often die in their early teens. The cause is a defect in a single gene, but it is a developmental gene. If your body is built in the wrong way, then you can’t just take a magic pill to rebuild it. If your brain is wired wrong, then it is wired wrong.

Matrix/DNA: Temos que por cada gene desenhado numa folha transparente e por esta folha sobre a fórmula da Matriz, para saber quem é aquele gene. Se é um arabe, muçulmano e portanto faz as coisas à sua maneira, ou se é um russo ortodoxo, etc. Tendo a posição dele na fita quimica do DNA saberemos o que sua versão matricial produzia na nebulosa de atomos, depois o que produzia nas galaxias, e o que tenta produzir no corpo humano. Temos de mudar certos conceitos atuais. Por exemplo quando Venter diz “it is a developmental gene” temos que entender que o gene expressa um certo momento e forma dentro de um ciclo vital, ou seja, um gene que atua mais em determinada fase de um processo. E tendo seu mapa é possivel localiza-lo numa das sete funções do ciclo vital da Matriz.  

 6) SPIEGEL: Who is to blame for those false expectations?

Venter: We were simply always looking at single genes because they were the only genes we had. When people lose their keys at night, they look under the lamp post. Why? Because that’s where you can still see something.

SPIEGEL: But the keys are really located in the dark?

Venter: Exactly. Why did people think there were so many human genes? It’s because they thought there was going to be one gene for each human trait. And if you want to cure greed, you change the greed gene, right? Or the envy gene, which is probably far more dangerous. But it turns out that we’re pretty complex. If you want to find out why someone gets Alzheimer’s or cancer, then it is not enough to look at one gene. To do so, we have to have the whole picture. It’s like saying you want to explore Valencia and the only thing you can see is this table. You see a little rust, but that tells you nothing about Valencia other than that the air is maybe salty. That’s where we are with the genome. We know nothing.

Matrix/DNA: A formula da Matriz neste caso é a lampada luminosa. The whole picture não é concernente a partes ou seja, genes, mas sim concernente ao sistema que as partes compõem.

7) SPIEGEL: Will that lead in the end to the kind of personalized medicine that genetic researchers have always touted? Each person would get his or her own personal treatment that is tailored precisely to that person’s genetic make-up?

Venter: That was another one of these silly naïve notions that was out there. It’s not, ‘Oh, we know your genome, we’re going to make this drug for you.’ That will never happen. It is more important that you use the information in the genome about your personal risks and reduce them through intelligent behavior.

Matrix/DNA: É isto aí. Comportamento inteligente anulando os riscos de variação genética as quais causam doenças e podem transmiti-las hereditariamente. Mas o que siginifica comportamento inteligente? Senão uma perfeita sintonia do corpo humano com o ritmo da Natureza ao redor, as vibrações, as composições das substancias, o momento evolucionario, etc.? É claro que o ser humano não é uma maquina que se auto-controla como um relógio tem seu todo controlado por uma disciplina severa de ritmo. O ser humano não consegue muita disciplina, mas principalmente porque ele foi gerado e vive num meio ainda selvagem, caótico, como o é a biosfera. Mas antes de desenhar o perfeito comportamento inteligente precisamos conhecer a fundo a natureza do meio-ambiente, saber qual seu ritmo e tendencias. Para isto precisamos conhecer a História Universal Natural e localizar nosso ambiente no devido ponto do espaço-tempo desta história. Nada melhor para isto que a história revelada pela Matriz. Tendo consciencia de como a natureza quer que nos comportemos a cada momento e evento e sabendo maneiras de contornar os nossos vicios vamos nos aproximando do comportamento que não produz variação genética.

8) SPIEGEL: When can we anticipate seeing the next tailor-made microbes from your laboratory?

Venter: Well, the goal is multifold. We have to start by creating minimal cells. A human cell is too complex — we have no idea how any human cell works. We don’t even know how the simplest bacterial cell works. We want to learn what the minimum cellular components are, so we’re going to be taking out all the non-essential genes. But we’re also trying to design new life forms for energy production, capturing carbon dioxide or to produce chemicals.

Matrix/DNA: Com a formula da Matriz nós temos melhor entendimento como uma célula trabalha. Por exemplo sabemos alinhar as organelas de acordo com o alinhamento sistêmico, o que revela entre outras, alguns mecanismos e invisiveis formas de interações entre as organelas. Reduzir a célula a seus componentes mais simples precisa antes entender que muitos dos componentes são resultantes da fuzzy logic, ou seja, resultam das interações entre os componentes essenciais. E tendo a célula desenhada numa folha transparente sobreposta à formula da Matriz torna-se facil ver o que é essencial ou não.

9) SPIEGEL: ExxonMobile, at the very least, appears to be convinced by your vision …

Venter: … yes, they are investing $600 million in the project, with half going to our partnership. It’s a good round number. It’s the same money that PerkinElmer gave me to decode the human genome. With it, we sequenced the human genome in nine months instead of many, many years. The public money that flowed into the Human Genome Project, above all, created an enormous, inflexible bureaucracy. And it is only because of private money that we can now sail across the ocean with this sailboat and discover 40 million genes — there are only 41 million genes known to all of science. All you need are a few innovative ideas and independent funding to allow you to do things that other people can only dream about.

Matrix/DNA: Craig Venter é a mente ideal para esta tarefa por ser brilhantemente pratica, pragmatica, realista, onde a fé e seus desvios misticos, se existe alguma, é deixada do lado de fora da porta do laboratório, ou do escritório da administração. Por isso ele nos surpreende com tantos rapidos e eficientes progressos. Falta a ele e sua equipe conhecer a formula da Matriz e entender que ela nada tem de pessoal imaginação humana mas sim é resultado do mais materialista e naturalista método conhecido, que é a anatomia comparada entre duas coisas diferentes anotando semelhanças e diferenças e tentando, experimentando previsões baseadas nos dados. Esta formula é a fonte de idéias inovativas que essa pesquisa está precisando, uma avalancha delas que nos ocorrem a todo momento que vemos os dados na banca do laboratório. Seria um minimo custo com uma recompensa inimaginavel se alguem que entende a formula como eu tenho estudado-a por 30 anos pudesse estar presente no laboratório, de inicio apenas como simples observador e aprendiz, para em seguida começar a expor as sugestões.     

Não somos os Genes do Criador, e sim, Vírus dentro do Criador?

domingo, abril 18th, 2010

Novidades na cosmovisão da Matriz/DNA. Acordei hoje com um pensamento perturbador que nunca havia pensado antes. Como é sabido, os modêlos desta cosmovisão indicam que este Universo – êste mundo material – é uma produção genética. De onde se conclui que – se ao menos aqui nestas regiões – o ser humano é o sistema mais evoluído que existe, êle deve ser o gene que carrega a mensagem e a missão reprodutora da fonte natural que gerou o Universo.

Mas… os mesmos modêlos podem dar margem a uma outra interpretação. É possível que êste Universo seja apenas parte do corpo, ou o corpo inteiro, da fonte natural. E que o ser humano tenha brotado, emergido nêle como os virus e as bactérias existem no corpo humano. Eu ainda não tive tempo de rever tôda a conjuntura dos modêlos para analizar esta hipótese, mas de imediato ela parece possível. Porém, se ela fôr o verdadeiro significado da nossa existência, muitas coisas devem mudar.

A genial frase de Einstein encerrando a questão magma que êle levou para seu tumulo sem resposta me ribombeia na cabeça: “Será o Universo amigável a nós?!”

Se sim, a Humanidade está salva e sua próxima forma transcendente terá um futuro grandioso garantido. Se não… estamos perdidos? Ainda não: existem bactérias más e existem boas, para o hospedeiro. Cabe a nós identificar o todo e descobrir como ser uma boa bactéria para o mundo. O Universo nos ignorará do mesmo jeito porem não acionará a fôrça de Clausius (a fôrça degenerativa do segundo principio da termodinâmica medida pela entropia),  para nos eliminar, como fêz com nosso ancestral LUCA (the Last Universal Common Ancestral).

Principalmente a existência da auto-consciência em nós, indica que somos genes? Cujo futuro é estarem todos reunidos num só ser e nascer para fora dêste Universo como o filho da fonte ex-machine? O que explicaria um monte de questões e aplacaria um monte de revoltas, como por exemplo, a existência de ricos e pobres se explicaria pelas dadas situações em que alguns genes devem se expressar enquanto outros devem se retrair como recessivos e apenas contribuir para que aqueles se expressem? Mas que tambem deixam muitas coisas absurdas sem explicação, como a cena de leões invadindo uma aldeia de nativos e estraçalhando mulheres e crianças.

Por outro lado, principalmente a influência humana no aquecimento global e alterações no planeta indica que somos virus ou bactérias… e malignas? Pode ser que sim, e a maioria das evid6encias imediatas sugerem lógicamente que esta é a verdade. Mas você pediu para nascer? Você tem culpa de ter sido feito assim, com êsse corpo cheio de necessidades parasitárias do planeta? No entanto você não é estupido como as bactérias malígnas em seu corpo. Você sabe que se matar o corpo que o hospeda… você é destruído junto com êle. E sabe que se você adoecer o corpo que o hospeda, haverá alterações nêle, que êle sentirá sua presença, e que êle dispõe de exércitos de defesa que serão lançados contra ti.

Este artigo parece reflexão inútil que não levaria a nada ( sem contar que para os místicos seria totalmente irracional), mas para mim êle tem um conteudo que deve ser memorizado, por isso o registro aqui. Penso ser muito importante correr-mos atrás de mais dados, científicos, investir-mos mais esfôrço na tecnologia espacial e micro-cósmica como os aceleradores de partículas, pois temos urgente que saber definir o que será uma boa bactéria amigável ao Universo enquanto também boas para nós mesmos. Precisamos de mais dados que nos conduza à Grande Unificação entre a relatividade geral, a quantica, a mecânica celestial de Newton, as quatro equações supremas do eletro-magnetismo de Maxuell, o elo entre evolução cosmológica e evolução biológica da Matriz/DNA e à resposta à questão de Einstein a qual é a nossa questão suprema.  Tais dados precisam revelar nossa real condição. O que somos, o que devemos fazer?